GALNT7 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15197-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GALNT7 Reagents
CRO Services
Product recommended

All GALNT7 Reagents
GALNT7 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2013 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
HindIII(two restriction sites) + XbaI(6kb+0.1kb+1.9kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GALNT7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GALNT7 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human GALNT7/GalNAc-T7 Gene Plasmid Map 15495
Human GALNT7/GalNAc-T7 Gene Expression validated Image 16661
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
GALNT7 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
GALNAC-T7 cDNA ORF Clone, Human;GalNAcT7 cDNA ORF Clone, Human
GALNT7 Background Information
Full Name
polypeptide N-acetylgalactosaminyltransferase 7

GALNT7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GALNT7 cDNA ORF Clone in Cloning Vector, Rat RG87814-U
GALNT7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87814-ACGLN

GALNT7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GALNT7 cDNA ORF Clone in Cloning Vector, Mouse MG5A3221-U
GALNT7 cDNA ORF Clone, Mouse, untagged MG5A3221-UT
GALNT7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3221-ACGLN
GALNT7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3221-ACG
GALNT7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3221-ANG
GALNT7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3221-ACR
GALNT7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3221-ANR
GALNT7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3221-CF
GALNT7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3221-NF
GALNT7 cDNA ORF Clone, Mouse, C-His tag MG5A3221-CH
GALNT7 cDNA ORF Clone, Mouse, N-His tag MG5A3221-NH
GALNT7 cDNA ORF Clone, Mouse, C-HA tag MG5A3221-CY
GALNT7 cDNA ORF Clone, Mouse, N-HA tag MG5A3221-NY
GALNT7 cDNA ORF Clone, Mouse, C-Myc tag MG5A3221-CM
GALNT7 cDNA ORF Clone, Mouse, N-Myc tag MG5A3221-NM

GALNT7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GALNT7 cDNA ORF Clone in Cloning Vector, Human HG15197-G
GALNT7 cDNA ORF Clone, Human, untagged HG15197-UT
GALNT7 cDNA ORF Clone, Human, C-GFPSpark® tag HG15197-ACG
GALNT7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15197-ACGLN
GALNT7 cDNA ORF Clone, Human, C-OFPSpark® tag HG15197-ACR
GALNT7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15197-CF
GALNT7 cDNA ORF Clone, Human, C-His tag HG15197-CH
GALNT7 cDNA ORF Clone, Human, N-His tag HG15197-NH
GALNT7 cDNA ORF Clone, Human, C-HA tag HG15197-CY
GALNT7 cDNA ORF Clone, Human, N-HA tag HG15197-NY
GALNT7 cDNA ORF Clone, Human, C-Myc tag HG15197-CM
GALNT7 cDNA ORF Clone, Human, N-Myc tag HG15197-NM
GALNT7 qPCR Primer Pairs, Human HP103823
info info
添加购物车成功! 添加购物车失败!