Quick Order

Text Size:AAA

Human GALNT2 / GalNAc-T2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human GALNT2 cDNA Clone Product Information
NCBI RefSeq:BC041120
RefSeq ORF Size:1716bp
cDNA Description:Full length Clone DNA of Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) with N terminal His tag.
Gene Synonym:GalNAc-T2, GALNT2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. GALNT2 may play a role in lipid metabolism. It catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. GALNT2 has a broad spectrum of substrates for peptides such as EA2, Muc5AC, Muc1a, Muc1b.

References
  • Bennett EP. et al., 1998, Glycobiology. 8 (6): 547-55.
  • White T. et al., 1995, J Biol Chem. 270 (41): 24156-65.
  • Bennett EP. et al., 1996, J Biol Chem. 271 (29): 17006-12.
  • Holleboom AG. et al., 2011, Cell Metab. 14 (6): 811-8.
  • Size / Price
    Catalog: HG13764-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"