Quick Order

Human GALK1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human GALK1 cDNA Clone Product Information
NCBI RefSeq:NM_000154.1
RefSeq ORF Size:1179bp
cDNA Description:Full length Clone DNA of Homo sapiens galactokinase 1 with N terminal His tag.
Gene Synonym:GK1, GALK, GALK1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GALK1 qPCR primers for gene expression analysis, HP101262 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to the GHMP kinase family and GalK subfamily. Galactokinase / GALK1 is a major enzyme for galactose metabolism. Galactokinase (GALK) deficiency is an autosomal recessive disorder characterized by elevation of blood galactose concentration and diminished galactose-1-phosphate, leading to the production of galactitol. Defects in GALK1 are the cause of galactosemia II ( GALCT2 ) which II is an autosomal recessive deficiency characterized by congenital cataracts during infancy and presenile cataracts in the adult population. The cataracts are secondary to accumulation of galactitol in the lenses.

References
  • Hunter,M. et al., 2001, Hum Mutat. 17 (1):77-8.
  • Park,H.D. et al., 2007, Mol Genet Metab. 91 (3):234-8.
  • Park,H.D. et al., 2009, BMC Med Genet. 10 :29.
  • Size / Price
    Catalog: HG11383-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"