After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GADD45G / CR6 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human GADD45G cDNA Clone Product Information
NCBI RefSeq:BC000465
RefSeq ORF Size:480bp
cDNA Description:Full length Clone DNA of Homo sapiens growth arrest and DNA-damage-inducible, gamma with N terminal His tag.
Gene Synonym:RP11-260L6.1, CR6, DDIT2, GADD45gamma, GRP17, GADD45G
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

GADD45G, also known as CR6, is part of the nuclear proteins to interact with various proteins whose transcript levels are raised after stressful growth arrest conditions and treatment with DNA-damaging agents. GADD45G reacts to environmental stresses by mediating activation of the p38/JNK pathway which is mediated through their protein binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. GADD45G acts as a new-age tumor suppressor however is being frequently inactivated epigenetically in multiple tumors. GADD45G mRNA expression is down-regulated in hepatocellular carcinoma. GADD45G causes cell cycle arrest at G2/M transition when transfected into Hep-G2 cells. GADD45G induction by androgens involves new protein synthesis. Overexpression of GADD45G inhibits cell growth and causes morphological modifications in prostate cell lines thus GADD45G takes part in differentiation induction by androgens.

References
  • Takekawa M. et al., 1998, Cell. 95 (4): 521-30.
  • Suzuki M. et al., 1999, J Hum Genet. 44 (5): 300-3.
  • Azam N. et al., 2001, J Biol Chem. 276 (4): 2766-74.
  • Size / Price
    Catalog: HG14379-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"