G0S2 cDNA ORF Clone, Human, N-His tag

Cat: HG15431-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All G0S2 Reagents
CRO Services
Product recommended

All G0S2 Reagents
G0S2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
312 bp
Description
Full length Clone DNA of Human G0/G1switch 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G0S2 Background Information
Full Name
G0/G1 switch 2

G0S2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
G0S2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1312-U
G0S2 cDNA ORF Clone, Mouse, untagged MG5A1312-UT
G0S2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1312-ACG
G0S2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1312-ACGLN
G0S2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1312-ANG
G0S2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1312-ACR
G0S2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1312-ANR
G0S2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1312-CF
G0S2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1312-NF
G0S2 cDNA ORF Clone, Mouse, C-His tag MG5A1312-CH
G0S2 cDNA ORF Clone, Mouse, N-His tag MG5A1312-NH
G0S2 cDNA ORF Clone, Mouse, C-HA tag MG5A1312-CY
G0S2 cDNA ORF Clone, Mouse, N-HA tag MG5A1312-NY
G0S2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1312-CM
G0S2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1312-NM

G0S2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
G0S2 cDNA ORF Clone in Cloning Vector, Human HG15431-G
G0S2 cDNA ORF Clone, Human, untagged HG15431-UT
G0S2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15431-ACGLN
G0S2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15431-ACG
G0S2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15431-ANG
G0S2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15431-ACR
G0S2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15431-ANR
G0S2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15431-CF
G0S2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15431-NF
G0S2 cDNA ORF Clone, Human, C-His tag HG15431-CH
G0S2 cDNA ORF Clone, Human, C-HA tag HG15431-CY
G0S2 cDNA ORF Clone, Human, N-HA tag HG15431-NY
G0S2 cDNA ORF Clone, Human, C-Myc tag HG15431-CM
G0S2 cDNA ORF Clone, Human, N-Myc tag HG15431-NM
G0S2 qPCR Primer Pairs, Human HP104055
info info
添加购物车成功! 添加购物车失败!