Quick Order

Human G0S2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human G0S2 cDNA Clone Product Information
NCBI RefSeq:BC009694
RefSeq ORF Size:312bp
cDNA Description:Full length Clone DNA of Homo sapiens G0/G1switch 2 DNA.
Gene Synonym:RP1-28O10.2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with G0S2 qPCR primers for gene expression analysis, HP104055 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"