Furin cDNA ORF Clone, Human, C-HA tag

Cat: HG10141-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Furin Reagents
CRO Services
Product recommended

All Furin Reagents
Furin cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2427 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1851G/C not causing the amino acid variation.
Description
Full length Clone DNA of Human furin (paired basic amino acid cleaving enzyme) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI(6kb+2.43kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Furin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Furin cDNA ORF Clone, Human, C-HA tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5622
Furin cDNA ORF Clone, Human, C-HA tag Alternative Names
FUR cDNA ORF Clone, Human;PACE cDNA ORF Clone, Human;PCSK3 cDNA ORF Clone, Human;SPC1 cDNA ORF Clone, Human
Furin Background Information
Full Name
furin (paired basic amino acid cleaving enzyme)

Furin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Furin cDNA ORF Clone in Cloning Vector, Mouse MG51079-G
Furin cDNA ORF Clone, Mouse, untagged MG51079-UT
Furin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51079-ACG
Furin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51079-ACGLN
Furin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51079-ACR
Furin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51079-CF
Furin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51079-NF
Furin cDNA ORF Clone, Mouse, C-His tag MG51079-CH
Furin cDNA ORF Clone, Mouse, N-His tag MG51079-NH
Furin cDNA ORF Clone, Mouse, C-HA tag MG51079-CY
Furin cDNA ORF Clone, Mouse, N-HA tag MG51079-NY
Furin cDNA ORF Clone, Mouse, C-Myc tag MG51079-CM
Furin cDNA ORF Clone, Mouse, N-Myc tag MG51079-NM
Furin qPCR Primer Pairs, Mouse MP201037

Furin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Furin cDNA ORF Clone in Cloning Vector, Human HG10141-M
Furin cDNA ORF Clone, Human, untagged HG10141-UT
Furin cDNA ORF Clone, Human, C-GFPSpark® tag HG10141-ACG
Furin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10141-ACGLN
Furin cDNA ORF Clone, Human, C-OFPSpark® tag HG10141-ACR
Furin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10141-CF
Furin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10141-NF
Furin cDNA ORF Clone, Human, C-His tag HG10141-CH
Furin cDNA ORF Clone, Human, N-His tag HG10141-NH
Furin cDNA ORF Clone, Human, N-HA tag HG10141-NY
Furin cDNA ORF Clone, Human, C-Myc tag HG10141-CM
Furin cDNA ORF Clone, Human, N-Myc tag HG10141-NM
Furin qPCR Primer Pairs, Human HP100212
info info
添加购物车成功! 添加购物车失败!