Follistatin cDNA ORF Clone, Human, untagged

Cat: HG10685-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Follistatin Reagents
CRO Services
Product recommended

All Follistatin Reagents
Follistatin cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human follistatin.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + NotI (6.1kb + 1.04kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Follistatin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Follistatin cDNA ORF Clone, Human, untagged Alternative Names
FS cDNA ORF Clone, Human
Follistatin Background Information

Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. follistatin are expressed and subserve local regulatory roles in numerous extragonadal tissues, including brain, adrenal, bone marrow, and placenta but perhaps most notably in anterior pituitary-the classical target tissue for inhibin, the activin-follistatin system may play a key role in early embryogenesis. Follistatin binds directly to activin and functions as an activin antagonist. Specific inhibitor of the biosynthesis and secretion of pituitary follicle stimulating hormone follistatin is a binding protein to activin. Since activin binds to follistatin, it is imperative to determine the nature of the activin/follistatin binding complex.

Full Name
follistatin
References
  • Carroll RS, et al. (1989) Inhibin, activin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol. 3(12): 1969-76.
  • Fainsod A, et al. (1997) The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech Dev. 63(1): 39-50.
  • Kaiser UB, et al. (1992) Follistatin gene expression in the pituitary: localization in gonadotropes and folliculostellate cells in diestrous rats. Endocrinology. 130(5): 3048-56.
  • info info
    添加购物车成功! 添加购物车失败!