Quick Order

Human Follistatin/FST Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FST cDNA Clone Product Information
NCBI RefSeq:NM_013409.1
RefSeq ORF Size:1035bp
cDNA Description:Full length Clone DNA of Homo sapiens follistatin.
Gene Synonym:FS, FST
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FST
Restriction Site:KpnI + NotI (6.1kb + 1.04kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. follistatin are expressed and subserve local regulatory roles in numerous extragonadal tissues, including brain, adrenal, bone marrow, and placenta but perhaps most notably in anterior pituitary-the classical target tissue for inhibin, the activin-follistatin system may play a key role in early embryogenesis. Follistatin binds directly to activin and functions as an activin antagonist. Specific inhibitor of the biosynthesis and secretion of pituitary follicle stimulating hormone follistatin is a binding protein to activin. Since activin binds to follistatin, it is imperative to determine the nature of the activin/follistatin binding complex.

References
  • Carroll RS, et al. (1989) Inhibin, activin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol. 3(12): 1969-76.
  • Fainsod A, et al. (1997) The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech Dev. 63(1): 39-50.
  • Kaiser UB, et al. (1992) Follistatin gene expression in the pituitary: localization in gonadotropes and folliculostellate cells in diestrous rats. Endocrinology. 130(5): 3048-56.
  • Size / Price
    Catalog: HG10685-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"