Quick Order

Text Size:AAA

Human Follistatin/FST Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human FST cDNA Clone Product Information
NCBI RefSeq:NM_013409.1
RefSeq ORF Size:1035bp
cDNA Description:Full length Clone DNA of Homo sapiens follistatin with C terminal Myc tag.
Gene Synonym:FS, FST
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. follistatin are expressed and subserve local regulatory roles in numerous extragonadal tissues, including brain, adrenal, bone marrow, and placenta but perhaps most notably in anterior pituitary-the classical target tissue for inhibin, the activin-follistatin system may play a key role in early embryogenesis. Follistatin binds directly to activin and functions as an activin antagonist. Specific inhibitor of the biosynthesis and secretion of pituitary follicle stimulating hormone follistatin is a binding protein to activin. Since activin binds to follistatin, it is imperative to determine the nature of the activin/follistatin binding complex.

References
  • Carroll RS, et al. (1989) Inhibin, activin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol. 3(12): 1969-76.
  • Fainsod A, et al. (1997) The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech Dev. 63(1): 39-50.
  • Kaiser UB, et al. (1992) Follistatin gene expression in the pituitary: localization in gonadotropes and folliculostellate cells in diestrous rats. Endocrinology. 130(5): 3048-56.
  • Size / Price
    Catalog: HG10685-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"