After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Fas Ligand / FASLG / CD95L Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FASLG cDNA Clone Product Information
NCBI RefSeq:NM_000639.1
RefSeq ORF Size:842bp
cDNA Description:Full length Clone DNA of Homo sapiens Fas ligand (TNF superfamily, member 6) (FASLG).
Gene Synonym:FASLG, FASL, CD178, CD95L, TNFSF6, APT1LG1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-FASLG
Restriction Site:HindIII + XbaI (5.5kb + 0.84kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FASLG Gene Plasmid Map
Human FasL/TNFSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human Fas Ligand / FASLG / CD95L Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Background

Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.

References
  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"