FZD1 cDNA ORF Clone, Human, N-HA tag

Cat: HG15229-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FZD1 Reagents
CRO Services
Product recommended

All FZD1 Reagents
FZD1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1944 bp
Description
Full length Clone DNA of Human frizzled family receptor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FZD1 Background Information

Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

Full Name
frizzled class receptor 1
References
  • Gazit A., et al.,(1999), Human frizzled 1 interacts with transforming Wnts to transduce a TCF dependent transcriptional response. Oncogene 18:5959-5966.
  • Sagara N., et al., (1998), Molecular cloning, differential expression, and chromosomal localization of human frizzled-1, frizzled-2, and frizzled-7.Biochem. Biophys. Res. Commun. 252:117-122.
  • Scherer S.W., et al.,(2003), Human chromosome 7: DNA sequence and biology.Science 300:767-772.
  • FZD1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FZD1 cDNA ORF Clone in Cloning Vector, Mouse MG50092-M
    FZD1 cDNA ORF Clone, Mouse, untagged MG50092-UT
    FZD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50092-ACGLN
    FZD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50092-ACG
    FZD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50092-ACR
    FZD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50092-CF
    FZD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50092-NF
    FZD1 cDNA ORF Clone, Mouse, C-His tag MG50092-CH
    FZD1 cDNA ORF Clone, Mouse, N-His tag MG50092-NH
    FZD1 cDNA ORF Clone, Mouse, C-HA tag MG50092-CY
    FZD1 cDNA ORF Clone, Mouse, N-HA tag MG50092-NY
    FZD1 cDNA ORF Clone, Mouse, C-Myc tag MG50092-CM
    FZD1 cDNA ORF Clone, Mouse, N-Myc tag MG50092-NM
    FZD1 qPCR Primer Pairs, Mouse MP200122

    FZD1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FZD1 cDNA ORF Clone in Cloning Vector, Human HG15229-G
    FZD1 cDNA ORF Clone, Human, untagged HG15229-UT
    FZD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15229-ACGLN
    FZD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15229-ACG
    FZD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15229-ACR
    FZD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15229-CF
    FZD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15229-NF
    FZD1 cDNA ORF Clone, Human, C-His tag HG15229-CH
    FZD1 cDNA ORF Clone, Human, N-His tag HG15229-NH
    FZD1 cDNA ORF Clone, Human, C-HA tag HG15229-CY
    FZD1 cDNA ORF Clone, Human, C-Myc tag HG15229-CM
    FZD1 cDNA ORF Clone, Human, N-Myc tag HG15229-NM
    FZD1 qPCR Primer Pairs, Human HP103855
    info info
    添加购物车成功! 添加购物车失败!