Quick Order

Human Frizzled-1/FZD1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human FZD1 cDNA Clone Product Information
NCBI RefSeq:NM_003505.1
RefSeq ORF Size:1944bp
cDNA Description:Full length Clone DNA of Homo sapiens frizzled family receptor 1 with C terminal HA tag.
Gene Synonym:FLJ95923, DKFZp564G072, FZD1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"