After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human FUT8 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FUT8 cDNA Clone Product Information
NCBI RefSeq:NM_178154.1
RefSeq ORF Size:1728bp
cDNA Description:Full length Clone DNA of Homo sapiens fucosyltransferase 8 (alpha (1,6) fucosyltransferase).
Gene Synonym:MGC26465, FUT8
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FUT8
Restriction Site:KpnI + XbaI (6.1kb + 1.73kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 165 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FUT8 Gene Plasmid Map
Human FUT8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Human alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family. Fucosyltransferases are the enzymes transferring fucose from GDP-Fuc to Gal in an alpha1,2-linkage and to GlcNAc in alpha1,3-linkage, alpha1,4-linkage, or alpha1,6-linkage. All fucosyltransferases utilize the same nucleotide sugar, their specificity reside in the recognition of the acceptor and in the type of linkage formed. Fucosyltransferases share some common structural and catalytic features. On the basis of protein sequence similarities, these enzymes can be classified into four distinct families: (1) the alpha-2-fucosyltransferases, (2) the alpha-3-fucosyltransferases, (3) the mammalian alpha-6-fucosyltransferases, and (4) the bacterial alpha-6-fucosyltransferases. The alpha-3-fucosyltransferases constitute a distinct family as they lack the consensus peptide, but some regions display similarities with the alpha-2 and alpha-6-fucosyltranferases.

References
  • Breton C, et al. (1998) Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology. 8(1): 87-94.
  • Oriol R, et al. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates, and bacteria. Glycobiology. 9(4): 323-34.
  • de Vries T, et al. (2001) Fucosyltransferases: structure / function studies. Glycobiology. 11(10): 119-128.
  • Baboval T, et al. (2002) Comparison of human and mouse Fuc-TX and Fuc-TXI genes, and expression studies in the mouse. Mamm Genome. 13(9): 538-41.
  • Size / Price
    Catalog: HG11326-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human FUT8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"