FUT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11331-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FUT2 Reagents
CRO Services
Product recommended

All FUT2 Reagents
FUT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032 bp
Description
Full length Clone DNA of Human fucosyltransferase 2 (secretor status included) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FUT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
B12QTL1 cDNA ORF Clone, Human;SE cDNA ORF Clone, Human;Se2 cDNA ORF Clone, Human;SEC2 cDNA ORF Clone, Human;sej cDNA ORF Clone, Human
FUT2 Background Information
Full Name
fucosyltransferase 2 (secretor status included)

FUT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FUT2 cDNA ORF Clone in Cloning Vector, Mouse MG53878-U
FUT2 cDNA ORF Clone, Mouse, untagged MG53878-UT
FUT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53878-ACG
FUT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53878-ACGLN
FUT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53878-ACR
FUT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53878-CF
FUT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53878-NF
FUT2 cDNA ORF Clone, Mouse, C-His tag MG53878-CH
FUT2 cDNA ORF Clone, Mouse, N-His tag MG53878-NH
FUT2 cDNA ORF Clone, Mouse, C-HA tag MG53878-CY
FUT2 cDNA ORF Clone, Mouse, N-HA tag MG53878-NY
FUT2 cDNA ORF Clone, Mouse, C-Myc tag MG53878-CM
FUT2 cDNA ORF Clone, Mouse, N-Myc tag MG53878-NM

FUT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FUT2 cDNA ORF Clone in Cloning Vector, Human HG11331-M
FUT2 cDNA ORF Clone, Human, untagged HG11331-UT
FUT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11331-ACG
FUT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11331-ACGLN
FUT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11331-ACR
FUT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11331-CF
FUT2 cDNA ORF Clone, Human, C-His tag HG11331-CH
FUT2 cDNA ORF Clone, Human, N-His tag HG11331-NH
FUT2 cDNA ORF Clone, Human, C-HA tag HG11331-CY
FUT2 cDNA ORF Clone, Human, N-HA tag HG11331-NY
FUT2 cDNA ORF Clone, Human, C-Myc tag HG11331-CM
FUT2 cDNA ORF Clone, Human, N-Myc tag HG11331-NM
FUT2 qPCR Primer Pairs, Human HP101216
info info
添加购物车成功! 添加购物车失败!