Quick Order

Human FUT2 Gene ORF cDNA clone expression plasmid

  • Human FUT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human FUT2 cDNA Clone Product Information
NCBI RefSeq:AY937240.1
RefSeq ORF Size:1032bp
cDNA Description:Full length Clone DNA of Homo sapiens fucosyltransferase 2 (secretor status included).
Gene Synonym:SE, Se2, sej, SEC2, B12QTL1, FUT2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FUT2
Restriction Site:KpnI + XbaI (6.1kb + 1.03kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for four point mutations: 204 A/G, 249 C/T, 390 C/T, 993 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FUT2 qPCR primers for gene expression analysis, HP101216 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FUT2 Gene Plasmid Map
Human FUT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11331-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"