FUNDC2 cDNA ORF Clone, Human, untagged

Cat: HG16828-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All FUNDC2 Reagents

CRO Services

Product recommended


All FUNDC2 Reagents

FUNDC2 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Human FUN14 domain containing 2.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FUNDC2 cDNA ORF Clone, Human, untagged Alternative Names

DC44 cDNA ORF Clone, Human;HCBP6 cDNA ORF Clone, Human;HCC3 cDNA ORF Clone, Human;PD03104 cDNA ORF Clone, Human

FUNDC2 Background Information

Full Name
FUN14 domain containing 2

FUNDC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FUNDC2 cDNA ORF Clone in Cloning Vector, Mouse MG51223-U
FUNDC2 cDNA ORF Clone, Mouse, untagged MG51223-UT
FUNDC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51223-ACGLN
FUNDC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51223-ACG
FUNDC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51223-ANG
FUNDC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51223-ACR
FUNDC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51223-ANR
FUNDC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51223-CF
FUNDC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51223-NF
FUNDC2 cDNA ORF Clone, Mouse, C-His tag MG51223-CH
FUNDC2 cDNA ORF Clone, Mouse, N-His tag MG51223-NH
FUNDC2 cDNA ORF Clone, Mouse, C-HA tag MG51223-CY
FUNDC2 cDNA ORF Clone, Mouse, N-HA tag MG51223-NY
FUNDC2 cDNA ORF Clone, Mouse, C-Myc tag MG51223-CM
FUNDC2 cDNA ORF Clone, Mouse, N-Myc tag MG51223-NM
FUNDC2 qPCR Primer Pairs, Mouse MP201106

FUNDC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FUNDC2 cDNA ORF Clone in Cloning Vector, Human HG16828-U
FUNDC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16828-ACG
FUNDC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16828-ACGLN
FUNDC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16828-ANG
FUNDC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16828-ACR
FUNDC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16828-ANR
FUNDC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16828-CF
FUNDC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16828-NF
FUNDC2 cDNA ORF Clone, Human, C-His tag HG16828-CH
FUNDC2 cDNA ORF Clone, Human, N-His tag HG16828-NH
FUNDC2 cDNA ORF Clone, Human, C-HA tag HG16828-CY
FUNDC2 cDNA ORF Clone, Human, N-HA tag HG16828-NY
FUNDC2 cDNA ORF Clone, Human, C-Myc tag HG16828-CM
FUNDC2 cDNA ORF Clone, Human, N-Myc tag HG16828-NM
info info
添加购物车成功! 添加购物车失败!