FUNDC2 cDNA ORF Clone, Human, N-His tag

Cat: HG16828-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FUNDC2 Reagents
CRO Services
Product recommended

All FUNDC2 Reagents
FUNDC2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Human FUN14 domain containing 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FUNDC2 cDNA ORF Clone, Human, N-His tag Alternative Names
DC44 cDNA ORF Clone, Human;HCBP6 cDNA ORF Clone, Human;HCC3 cDNA ORF Clone, Human;PD03104 cDNA ORF Clone, Human
FUNDC2 Background Information
Full Name
FUN14 domain containing 2

FUNDC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FUNDC2 cDNA ORF Clone in Cloning Vector, Mouse MG51223-U
FUNDC2 cDNA ORF Clone, Mouse, untagged MG51223-UT
FUNDC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51223-ACG
FUNDC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51223-ACGLN
FUNDC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51223-ANG
FUNDC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51223-ACR
FUNDC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51223-ANR
FUNDC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51223-CF
FUNDC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51223-NF
FUNDC2 cDNA ORF Clone, Mouse, C-His tag MG51223-CH
FUNDC2 cDNA ORF Clone, Mouse, N-His tag MG51223-NH
FUNDC2 cDNA ORF Clone, Mouse, C-HA tag MG51223-CY
FUNDC2 cDNA ORF Clone, Mouse, N-HA tag MG51223-NY
FUNDC2 cDNA ORF Clone, Mouse, C-Myc tag MG51223-CM
FUNDC2 cDNA ORF Clone, Mouse, N-Myc tag MG51223-NM
FUNDC2 qPCR Primer Pairs, Mouse MP201106

FUNDC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FUNDC2 cDNA ORF Clone in Cloning Vector, Human HG16828-U
FUNDC2 cDNA ORF Clone, Human, untagged HG16828-UT
FUNDC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16828-ACGLN
FUNDC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16828-ACG
FUNDC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16828-ANG
FUNDC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16828-ACR
FUNDC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16828-ANR
FUNDC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16828-CF
FUNDC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16828-NF
FUNDC2 cDNA ORF Clone, Human, C-His tag HG16828-CH
FUNDC2 cDNA ORF Clone, Human, C-HA tag HG16828-CY
FUNDC2 cDNA ORF Clone, Human, N-HA tag HG16828-NY
FUNDC2 cDNA ORF Clone, Human, C-Myc tag HG16828-CM
FUNDC2 cDNA ORF Clone, Human, N-Myc tag HG16828-NM
info info
添加购物车成功! 添加购物车失败!