FUCA2 cDNA ORF Clone, Human, C-HA tag

Cat: HG13429-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FUCA2 Reagents
CRO Services
Product recommended

All FUCA2 Reagents
FUCA2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Human fucosidase, alpha-L-2, plasma with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FUCA2 cDNA ORF Clone, Human, C-HA tag Alternative Names
dJ20N2.5 cDNA ORF Clone, Human
FUCA2 Background Information
Full Name
fucosidase, alpha-L- 2, plasma

FUCA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FUCA2 cDNA ORF Clone in Cloning Vector, Rat RG80851-U
FUCA2 cDNA ORF Clone, Rat, untagged RG80851-UT
FUCA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80851-ACGLN
FUCA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80851-ACG
FUCA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80851-ACR
FUCA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80851-CF
FUCA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80851-NF
FUCA2 cDNA ORF Clone, Rat, C-His tag RG80851-CH
FUCA2 cDNA ORF Clone, Rat, N-His tag RG80851-NH
FUCA2 cDNA ORF Clone, Rat, C-HA tag RG80851-CY
FUCA2 cDNA ORF Clone, Rat, N-HA tag RG80851-NY
FUCA2 cDNA ORF Clone, Rat, C-Myc tag RG80851-CM
FUCA2 cDNA ORF Clone, Rat, N-Myc tag RG80851-NM
FUCA2 qPCR Primer Pairs, Rat RP300815

FUCA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FUCA2 cDNA ORF Clone in Cloning Vector, Mouse MG53080-G
FUCA2 cDNA ORF Clone, Mouse, untagged MG53080-UT
FUCA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53080-ACG
FUCA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53080-ACGLN
FUCA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53080-ACR
FUCA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53080-CF
FUCA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53080-NF
FUCA2 cDNA ORF Clone, Mouse, C-His tag MG53080-CH
FUCA2 cDNA ORF Clone, Mouse, N-His tag MG53080-NH
FUCA2 cDNA ORF Clone, Mouse, C-HA tag MG53080-CY
FUCA2 cDNA ORF Clone, Mouse, N-HA tag MG53080-NY
FUCA2 cDNA ORF Clone, Mouse, C-Myc tag MG53080-CM
FUCA2 cDNA ORF Clone, Mouse, N-Myc tag MG53080-NM

FUCA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FUCA2 cDNA ORF Clone in Cloning Vector, Human HG13429-G
FUCA2 cDNA ORF Clone, Human, untagged HG13429-UT
FUCA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13429-ACG
FUCA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13429-ACGLN
FUCA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13429-ACR
FUCA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13429-CF
FUCA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13429-NF
FUCA2 cDNA ORF Clone, Human, C-His tag HG13429-CH
FUCA2 cDNA ORF Clone, Human, N-His tag HG13429-NH
FUCA2 cDNA ORF Clone, Human, N-HA tag HG13429-NY
FUCA2 cDNA ORF Clone, Human, C-Myc tag HG13429-CM
FUCA2 cDNA ORF Clone, Human, N-Myc tag HG13429-NM
FUCA2 qPCR Primer Pairs, Human HP102131
info info
添加购物车成功! 添加购物车失败!