After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FUCA1 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human FUCA1 cDNA Clone Product Information
NCBI RefSeq:BC017338
RefSeq ORF Size:1386bp
cDNA Description:Full length Clone DNA of Homo sapiens fucosidase, alpha-L- 1, tissue with N terminal Myc tag.
Gene Synonym:RP11-45G17.1, FUCA, FUCA1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

FUCA1 is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in FUCA1 gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. Different phenotypes include clinical features such as neurologic deterioration, growth retardation, visceromegaly, and seizures in a severe early form; coarse facial features, angiokeratoma corporis diffusum, spasticity and delayed psychomotor development in a longer surviving form; and an unusual spondylometaphyseoepiphyseal dysplasia in yet another form.

References
  • Yang M, et al. (1993) A mutation generating a stop codon in the alpha-L-fucosidase gene of a fucosidosis patient. Biochem Biophys Res Commun. 189(2):1063-8.
  • Fukushima H, et al. (1991) Sequencing and expression of a full-length cDNA for human alpha-L-fucosidase. J Inherit Metab Dis. 13(5):761-5.
  • Kretz KA, et al. (1990) Characterization of EcoRI mutation in fucosidosis patients: a stop codon in the open reading frame. J Mol Neurosci. 1(3):177-80.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"