Text Size:AAA

Human FUCA1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human FUCA1 cDNA Clone Product Information
NCBI RefSeq:BC017338
RefSeq ORF Size:1386bp
cDNA Description:Full length Clone DNA of Homo sapiens fucosidase, alpha-L- 1, tissue with N terminal HA tag.
Gene Synonym:RP11-45G17.1, FUCA, FUCA1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

FUCA1 is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in FUCA1 gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. Different phenotypes include clinical features such as neurologic deterioration, growth retardation, visceromegaly, and seizures in a severe early form; coarse facial features, angiokeratoma corporis diffusum, spasticity and delayed psychomotor development in a longer surviving form; and an unusual spondylometaphyseoepiphyseal dysplasia in yet another form.

References
  • Yang M, et al. (1993) A mutation generating a stop codon in the alpha-L-fucosidase gene of a fucosidosis patient. Biochem Biophys Res Commun. 189(2):1063-8.
  • Fukushima H, et al. (1991) Sequencing and expression of a full-length cDNA for human alpha-L-fucosidase. J Inherit Metab Dis. 13(5):761-5.
  • Kretz KA, et al. (1990) Characterization of EcoRI mutation in fucosidosis patients: a stop codon in the open reading frame. J Mol Neurosci. 1(3):177-80.
  • Size / Price
    Catalog: HG13893-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"