FTSJ2 cDNA ORF Clone, Human, N-OFPSpark® tag

Cat: HG16323-ANR
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FTSJ2 Reagents
CRO Services
Product recommended

All FTSJ2 Reagents
FTSJ2 cDNA ORF Clone, Human, N-OFPSpark® tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Human FtsJ RNA methyltransferase homolog 2 (E. coli) with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTSJ2 cDNA ORF Clone, Human, N-OFPSpark® tag Alternative Names
FJH1 cDNA ORF Clone, Human;HEL97 cDNA ORF Clone, Human;MRM2 cDNA ORF Clone, Human;RRMJ2 cDNA ORF Clone, Human
FTSJ2 Background Information
Full Name
FtsJ RNA methyltransferase homolog 2 (E. coli)

FTSJ2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FTSJ2 cDNA ORF Clone in Cloning Vector, Mouse MG51765-G
FTSJ2 cDNA ORF Clone, Mouse, untagged MG51765-UT
FTSJ2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51765-ACG
FTSJ2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51765-ACGLN
FTSJ2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51765-ANG
FTSJ2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51765-ACR
FTSJ2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51765-ANR
FTSJ2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51765-CF
FTSJ2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51765-NF
FTSJ2 cDNA ORF Clone, Mouse, C-His tag MG51765-CH
FTSJ2 cDNA ORF Clone, Mouse, N-His tag MG51765-NH
FTSJ2 cDNA ORF Clone, Mouse, C-HA tag MG51765-CY
FTSJ2 cDNA ORF Clone, Mouse, N-HA tag MG51765-NY
FTSJ2 cDNA ORF Clone, Mouse, C-Myc tag MG51765-CM
FTSJ2 cDNA ORF Clone, Mouse, N-Myc tag MG51765-NM
FTSJ2 qPCR Primer Pairs, Mouse MP201638

FTSJ2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FTSJ2 cDNA ORF Clone in Cloning Vector, Human HG16323-G
FTSJ2 cDNA ORF Clone, Human, untagged HG16323-UT
FTSJ2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16323-ACGLN
FTSJ2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16323-ACG
FTSJ2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16323-ANG
FTSJ2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16323-ACR
FTSJ2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16323-CF
FTSJ2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16323-NF
FTSJ2 cDNA ORF Clone, Human, C-His tag HG16323-CH
FTSJ2 cDNA ORF Clone, Human, N-His tag HG16323-NH
FTSJ2 cDNA ORF Clone, Human, C-HA tag HG16323-CY
FTSJ2 cDNA ORF Clone, Human, N-HA tag HG16323-NY
FTSJ2 cDNA ORF Clone, Human, C-Myc tag HG16323-CM
FTSJ2 cDNA ORF Clone, Human, N-Myc tag HG16323-NM
FTSJ2 qPCR Primer Pairs, Human HP105076
info info
添加购物车成功! 添加购物车失败!