FTO cDNA ORF Clone, Human, C-Myc tag

Cat: HG12125-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All FTO Reagents

CRO Services

Product recommended


All FTO Reagents

FTO cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1563 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fat mass and obesity associated with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.56kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FTO cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTO cDNA ORF Clone, Human, C-Myc tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5611

FTO cDNA ORF Clone, Human, C-Myc tag Alternative Names

ALKBH9 cDNA ORF Clone, Human

FTO Background Information

Polymorphisms in the FTO gene are associated with obesity and body mass index in humans and livestock. Fat mass and obesity-associated (FTO) protein is a ferrous ion (Fe2+)/2-oxoglutarate (2-OG)-dependent demethylase preferentially catalyzing m6A sites in RNA. The FTO gene is highly expressed in the hypothalamus with fluctuation in response to various nutritional conditions, which is believed to be involved in the control of whole body metabolism. The fat mass and obesity-related (FTO) gene has a strong relationship with obesity, extreme obesity and inflammatory state, and may also be associated with food intake regulation. SNPs in the first intron of FTO convey effects on adiposity by mechanisms that remain unclear, but appear to include modulation of expression of FTO itself, as well as other genes in cis. FTO expression is lower in fibroblasts and iPSC-derived neurons of individuals segregating for FTO obesity risk alleles. The overexpression of FTO had been demonstrated that in mouse models of MI decreased fibrosis and enhanced angiogenesis.
Full Name
fat mass and obesity associated

FTO cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Rat RG80935-U
FTO cDNA ORF Clone, Rat, untagged RG80935-UT
FTO cDNA ORF Clone, Rat, C-GFPSpark® tag RG80935-ACG
FTO Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80935-ACGLN
FTO cDNA ORF Clone, Rat, N-GFPSpark® tag RG80935-ANG
FTO cDNA ORF Clone, Rat, C-OFPSpark® tag RG80935-ACR
FTO cDNA ORF Clone, Rat, N-OFPSpark® tag RG80935-ANR
FTO cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80935-CF
FTO cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80935-NF
FTO cDNA ORF Clone, Rat, C-His tag RG80935-CH
FTO cDNA ORF Clone, Rat, N-His tag RG80935-NH
FTO cDNA ORF Clone, Rat, C-HA tag RG80935-CY
FTO cDNA ORF Clone, Rat, N-HA tag RG80935-NY
FTO cDNA ORF Clone, Rat, C-Myc tag RG80935-CM
FTO cDNA ORF Clone, Rat, N-Myc tag RG80935-NM
FTO qPCR Primer Pairs, Rat RP300899

FTO cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Mouse MG53159-G
FTO cDNA ORF Clone, Mouse, untagged MG53159-UT
FTO Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53159-ACGLN
FTO cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53159-ACG
FTO cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53159-ANG
FTO cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53159-ACR
FTO cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53159-ANR
FTO cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53159-CF
FTO cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53159-NF
FTO cDNA ORF Clone, Mouse, C-His tag MG53159-CH
FTO cDNA ORF Clone, Mouse, N-His tag MG53159-NH
FTO cDNA ORF Clone, Mouse, C-HA tag MG53159-CY
FTO cDNA ORF Clone, Mouse, N-HA tag MG53159-NY
FTO cDNA ORF Clone, Mouse, C-Myc tag MG53159-CM
FTO cDNA ORF Clone, Mouse, N-Myc tag MG53159-NM

FTO cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Human HG12125-G
FTO cDNA ORF Clone, Human, untagged HG12125-UT
FTO cDNA ORF Clone, Human, C-GFPSpark® tag HG12125-ACG
FTO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12125-ACGLN
FTO cDNA ORF Clone, Human, N-GFPSpark® tag HG12125-ANG
FTO cDNA ORF Clone, Human, C-OFPSpark® tag HG12125-ACR
FTO cDNA ORF Clone, Human, N-OFPSpark® tag HG12125-ANR
FTO cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12125-CF
FTO cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12125-NF
FTO cDNA ORF Clone, Human, C-His tag HG12125-CH
FTO cDNA ORF Clone, Human, N-His tag HG12125-NH
FTO cDNA ORF Clone, Human, C-HA tag HG12125-CY
FTO cDNA ORF Clone, Human, N-HA tag HG12125-NY
FTO cDNA ORF Clone, Human, N-Myc tag HG12125-NM
FTO qPCR Primer Pairs, Human HP101651
info info
添加购物车成功! 添加购物车失败!