FTO cDNA ORF Clone, Human, C-GFPSpark® tag

Cat: HG12125-ACG
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FTO Reagents
CRO Services
Product recommended

All FTO Reagents
FTO cDNA ORF Clone, Human, C-GFPSpark® tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fat mass and obesity associated with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-GFPSpark
Restriction Sites
KpnI + XbaI (6kb + 2.25kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FTO cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTO cDNA ORF Clone, Human, C-GFPSpark® tag Validated Images
Human Fat mass and obesity associated/FTO Gene Expression validated Image 936
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
other Green fluorescent protein / GFP Gene Plasmid Map 5607
FTO cDNA ORF Clone, Human, C-GFPSpark® tag Alternative Names
ALKBH9 cDNA ORF Clone, Human
FTO Background Information
Full Name
fat mass and obesity associated

FTO cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Rat RG80935-U
FTO cDNA ORF Clone, Rat, untagged RG80935-UT
FTO Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80935-ACGLN
FTO cDNA ORF Clone, Rat, C-GFPSpark® tag RG80935-ACG
FTO cDNA ORF Clone, Rat, N-GFPSpark® tag RG80935-ANG
FTO cDNA ORF Clone, Rat, C-OFPSpark® tag RG80935-ACR
FTO cDNA ORF Clone, Rat, N-OFPSpark® tag RG80935-ANR
FTO cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80935-CF
FTO cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80935-NF
FTO cDNA ORF Clone, Rat, C-His tag RG80935-CH
FTO cDNA ORF Clone, Rat, N-His tag RG80935-NH
FTO cDNA ORF Clone, Rat, C-HA tag RG80935-CY
FTO cDNA ORF Clone, Rat, N-HA tag RG80935-NY
FTO cDNA ORF Clone, Rat, C-Myc tag RG80935-CM
FTO cDNA ORF Clone, Rat, N-Myc tag RG80935-NM
FTO qPCR Primer Pairs, Rat RP300899

FTO cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Mouse MG53159-G
FTO cDNA ORF Clone, Mouse, untagged MG53159-UT
FTO Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53159-ACGLN
FTO cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53159-ACG
FTO cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53159-ANG
FTO cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53159-ACR
FTO cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53159-ANR
FTO cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53159-CF
FTO cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53159-NF
FTO cDNA ORF Clone, Mouse, C-His tag MG53159-CH
FTO cDNA ORF Clone, Mouse, N-His tag MG53159-NH
FTO cDNA ORF Clone, Mouse, C-HA tag MG53159-CY
FTO cDNA ORF Clone, Mouse, N-HA tag MG53159-NY
FTO cDNA ORF Clone, Mouse, C-Myc tag MG53159-CM
FTO cDNA ORF Clone, Mouse, N-Myc tag MG53159-NM

FTO cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FTO cDNA ORF Clone in Cloning Vector, Human HG12125-G
FTO cDNA ORF Clone, Human, untagged HG12125-UT
FTO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12125-ACGLN
FTO cDNA ORF Clone, Human, N-GFPSpark® tag HG12125-ANG
FTO cDNA ORF Clone, Human, C-OFPSpark® tag HG12125-ACR
FTO cDNA ORF Clone, Human, N-OFPSpark® tag HG12125-ANR
FTO cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12125-CF
FTO cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12125-NF
FTO cDNA ORF Clone, Human, C-His tag HG12125-CH
FTO cDNA ORF Clone, Human, N-His tag HG12125-NH
FTO cDNA ORF Clone, Human, C-HA tag HG12125-CY
FTO cDNA ORF Clone, Human, N-HA tag HG12125-NY
FTO cDNA ORF Clone, Human, C-Myc tag HG12125-CM
FTO cDNA ORF Clone, Human, N-Myc tag HG12125-NM
FTO qPCR Primer Pairs, Human HP101651
info info
添加购物车成功! 添加购物车失败!