Quick Order

Text Size:AAA

Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FTO cDNA Clone Product Information
NCBI RefSeq:NM_001080432.2
RefSeq ORF Size:1518bp
cDNA Description:Full length Clone DNA of Homo sapiens fat mass and obesity associated.
Gene Synonym:MGC5149, KIAA1752, FTO
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FTO
Restriction Site:KpnI + XbaI (6.1kb + 1.52kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FTO Gene Plasmid Map
Human FTO Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid on other vectors
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG12125-ACG$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG12125-ACR$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG12125-ANG$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG12125-ANR$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-Flag tagHG12125-CF$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-His tagHG12125-CH$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-Myc tagHG12125-CM$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-HA tagHG12125-CY$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone in cloning vectorHG12125-G$75
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-Flag tagHG12125-G-F$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-Flag tagHG12125-NF$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-His tagHG12125-NH$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-Myc tagHG12125-NM$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-HA tagHG12125-NY$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmidHG12125-UT$215
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"