Quick Order

Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human FTO cDNA Clone Product Information
NCBI RefSeq:NM_001080432.2
RefSeq ORF Size:1518bp
cDNA Description:Full length Clone DNA of Homo sapiens fat mass and obesity associated with C terminal His tag.
Gene Synonym:MGC5149, KIAA1752, FTO
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-FTO-His
Restriction Site:KpnI + XbaI (6kb + 1.56kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FTO Gene Plasmid Map
Human FTO ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG12125-ACG$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG12125-ACR$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG12125-ANG$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG12125-ANR$245
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-Flag tagHG12125-CF$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-His tagHG12125-CH$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-Myc tagHG12125-CM$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, C-HA tagHG12125-CY$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone in cloning vectorHG12125-G$75
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-Flag tagHG12125-NF$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-His tagHG12125-NH$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-Myc tagHG12125-NM$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmid, N-HA tagHG12125-NY$215
Human Fat mass and obesity associated/FTO Gene ORF cDNA clone expression plasmidHG12125-UT$215
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG12125-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human FTO ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"