Ferritin light chain cDNA ORF Clone, Human, untagged

Cat: HG16460-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Ferritin light chain Reagents

CRO Services

Product recommended


All Ferritin light chain Reagents

Ferritin light chain cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Human ferritin, light polypeptide.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ferritin light chain cDNA ORF Clone, Human, untagged Alternative Names

LFTD cDNA ORF Clone, Human;MGC71996 cDNA ORF Clone, Human;NBIA3 cDNA ORF Clone, Human

Ferritin light chain Background Information

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.
Full Name
ferritin, light polypeptide
References
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Ferritin light chain cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Canine DG70148-U
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Canine DG70170-U
    Ferritin light chain cDNA ORF Clone, Canine, untagged DG70170-UT
    Ferritin light chain cDNA ORF Clone, Canine, C-GFPSpark® tag DG70170-ACG
    Ferritin light chain Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70170-ACGLN
    Ferritin light chain cDNA ORF Clone, Canine, N-GFPSpark® tag DG70170-ANG
    Ferritin light chain cDNA ORF Clone, Canine, C-OFPSpark® tag DG70170-ACR
    Ferritin light chain cDNA ORF Clone, Canine, N-OFPSpark® tag DG70170-ANR
    Ferritin light chain cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70170-CF
    Ferritin light chain cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70170-NF
    Ferritin light chain cDNA ORF Clone, Canine, C-His tag DG70170-CH
    Ferritin light chain cDNA ORF Clone, Canine, N-His tag DG70170-NH
    Ferritin light chain cDNA ORF Clone, Canine, C-HA tag DG70170-CY
    Ferritin light chain cDNA ORF Clone, Canine, N-HA tag DG70170-NY
    Ferritin light chain cDNA ORF Clone, Canine, C-Myc tag DG70170-CM
    Ferritin light chain cDNA ORF Clone, Canine, N-Myc tag DG70170-NM

    Ferritin light chain cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Cynomolgus CG90514-U
    Ferritin light chain cDNA ORF Clone, Cynomolgus, untagged CG90514-UT
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90514-ACG
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90514-ANG
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90514-ACR
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90514-ANR
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90514-CF
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90514-NF
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-His tag CG90514-CH
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-His tag CG90514-NH
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-HA tag CG90514-CY
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-HA tag CG90514-NY
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-Myc tag CG90514-CM
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-Myc tag CG90514-NM

    Ferritin light chain cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90514-ACGLN

    Ferritin light chain cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Rabbit TG65073-G
    Ferritin light chain cDNA ORF Clone, Rabbit, untagged TG65073-UT
    Ferritin light chain cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65073-ACG
    Ferritin light chain Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65073-ACGLN
    Ferritin light chain cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65073-ANG
    Ferritin light chain cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65073-ACR
    Ferritin light chain cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65073-ANR
    Ferritin light chain cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65073-CF
    Ferritin light chain cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65073-NF
    Ferritin light chain cDNA ORF Clone, Rabbit, C-His tag TG65073-CH
    Ferritin light chain cDNA ORF Clone, Rabbit, N-His tag TG65073-NH
    Ferritin light chain cDNA ORF Clone, Rabbit, C-HA tag TG65073-CY
    Ferritin light chain cDNA ORF Clone, Rabbit, N-HA tag TG65073-NY
    Ferritin light chain cDNA ORF Clone, Rabbit, C-Myc tag TG65073-CM
    Ferritin light chain cDNA ORF Clone, Rabbit, N-Myc tag TG65073-NM

    Ferritin light chain cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Rat RG80491-U
    Ferritin light chain cDNA ORF Clone, Rat, untagged RG80491-UT
    Ferritin light chain Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80491-ACGLN
    Ferritin light chain cDNA ORF Clone, Rat, C-GFPSpark® tag RG80491-ACG
    Ferritin light chain cDNA ORF Clone, Rat, N-GFPSpark® tag RG80491-ANG
    Ferritin light chain cDNA ORF Clone, Rat, C-OFPSpark® tag RG80491-ACR
    Ferritin light chain cDNA ORF Clone, Rat, N-OFPSpark® tag RG80491-ANR
    Ferritin light chain cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80491-CF
    Ferritin light chain cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80491-NF
    Ferritin light chain cDNA ORF Clone, Rat, C-His tag RG80491-CH
    Ferritin light chain cDNA ORF Clone, Rat, N-His tag RG80491-NH
    Ferritin light chain cDNA ORF Clone, Rat, C-HA tag RG80491-CY
    Ferritin light chain cDNA ORF Clone, Rat, N-HA tag RG80491-NY
    Ferritin light chain cDNA ORF Clone, Rat, C-Myc tag RG80491-CM
    Ferritin light chain cDNA ORF Clone, Rat, N-Myc tag RG80491-NM
    Ferritin light chain qPCR Primer Pairs, Rat RP300455

    Ferritin light chain cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Human HG16460-G
    Ferritin light chain cDNA ORF Clone, Human, untagged HG12482-UT
    Ferritin light chain Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12482-ACGLN
    Ferritin light chain Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16460-ACGLN
    Ferritin light chain cDNA ORF Clone, Human, C-GFPSpark® tag HG16460-ACG
    Ferritin light chain cDNA ORF Clone, Human, N-GFPSpark® tag HG16460-ANG
    Ferritin light chain cDNA ORF Clone, Human, C-OFPSpark® tag HG16460-ACR
    Ferritin light chain cDNA ORF Clone, Human, N-OFPSpark® tag HG16460-ANR
    Ferritin light chain cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16460-CF
    Ferritin light chain cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16460-NF
    Ferritin light chain cDNA ORF Clone, Human, C-His tag HG16460-CH
    Ferritin light chain cDNA ORF Clone, Human, N-His tag HG16460-NH
    Ferritin light chain cDNA ORF Clone, Human, C-HA tag HG16460-CY
    Ferritin light chain cDNA ORF Clone, Human, N-HA tag HG16460-NY
    Ferritin light chain cDNA ORF Clone, Human, C-Myc tag HG16460-CM
    Ferritin light chain cDNA ORF Clone, Human, N-Myc tag HG16460-NM
    Ferritin light chain qPCR Primer Pairs, Human HP104808
    info info
    添加购物车成功! 添加购物车失败!