Ferritin light chain cDNA ORF Clone, Human, C-OFPSpark® tag

Cat: HG16460-ACR
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Ferritin light chain Reagents
CRO Services
Product recommended

All Ferritin light chain Reagents
Ferritin light chain cDNA ORF Clone, Human, C-OFPSpark® tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Human ferritin, light polypeptide with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ferritin light chain cDNA ORF Clone, Human, C-OFPSpark® tag Alternative Names
LFTD cDNA ORF Clone, Human;MGC71996 cDNA ORF Clone, Human;NBIA3 cDNA ORF Clone, Human
Ferritin light chain Background Information

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

Full Name
ferritin, light polypeptide
References
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Ferritin light chain cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Cynomolgus CG90514-U
    Ferritin light chain cDNA ORF Clone, Cynomolgus, untagged CG90514-UT
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90514-ACG
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90514-ANG
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90514-ACR
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90514-ANR
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90514-CF
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90514-NF
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-His tag CG90514-CH
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-His tag CG90514-NH
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-HA tag CG90514-CY
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-HA tag CG90514-NY
    Ferritin light chain cDNA ORF Clone, Cynomolgus, C-Myc tag CG90514-CM
    Ferritin light chain cDNA ORF Clone, Cynomolgus, N-Myc tag CG90514-NM

    Ferritin light chain cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Canine DG70148-U
    Ferritin light chain Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70170-ACGLN

    Ferritin light chain cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90514-ACGLN

    Ferritin light chain cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Rabbit TG65073-G
    Ferritin light chain cDNA ORF Clone, Rabbit, untagged TG65073-UT
    Ferritin light chain cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65073-ACG
    Ferritin light chain Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65073-ACGLN
    Ferritin light chain cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65073-ANG
    Ferritin light chain cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65073-ACR
    Ferritin light chain cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65073-ANR
    Ferritin light chain cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65073-CF
    Ferritin light chain cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65073-NF
    Ferritin light chain cDNA ORF Clone, Rabbit, C-His tag TG65073-CH
    Ferritin light chain cDNA ORF Clone, Rabbit, N-His tag TG65073-NH
    Ferritin light chain cDNA ORF Clone, Rabbit, C-HA tag TG65073-CY
    Ferritin light chain cDNA ORF Clone, Rabbit, N-HA tag TG65073-NY
    Ferritin light chain cDNA ORF Clone, Rabbit, C-Myc tag TG65073-CM
    Ferritin light chain cDNA ORF Clone, Rabbit, N-Myc tag TG65073-NM

    Ferritin light chain cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Rat RG80491-U
    Ferritin light chain cDNA ORF Clone, Rat, untagged RG80491-UT
    Ferritin light chain cDNA ORF Clone, Rat, C-GFPSpark® tag RG80491-ACG
    Ferritin light chain Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80491-ACGLN
    Ferritin light chain cDNA ORF Clone, Rat, N-GFPSpark® tag RG80491-ANG
    Ferritin light chain cDNA ORF Clone, Rat, C-OFPSpark® tag RG80491-ACR
    Ferritin light chain cDNA ORF Clone, Rat, N-OFPSpark® tag RG80491-ANR
    Ferritin light chain cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80491-CF
    Ferritin light chain cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80491-NF
    Ferritin light chain cDNA ORF Clone, Rat, C-His tag RG80491-CH
    Ferritin light chain cDNA ORF Clone, Rat, N-His tag RG80491-NH
    Ferritin light chain cDNA ORF Clone, Rat, C-HA tag RG80491-CY
    Ferritin light chain cDNA ORF Clone, Rat, N-HA tag RG80491-NY
    Ferritin light chain cDNA ORF Clone, Rat, C-Myc tag RG80491-CM
    Ferritin light chain cDNA ORF Clone, Rat, N-Myc tag RG80491-NM
    Ferritin light chain qPCR Primer Pairs, Rat RP300455

    Ferritin light chain cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ferritin light chain cDNA ORF Clone in Cloning Vector, Human HG16460-G
    Ferritin light chain cDNA ORF Clone, Human, untagged HG12482-UT
    Ferritin light chain cDNA ORF Clone, Human, untagged HG16460-UT
    Ferritin light chain Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16460-ACGLN
    Ferritin light chain cDNA ORF Clone, Human, C-GFPSpark® tag HG16460-ACG
    Ferritin light chain Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12482-ACGLN
    Ferritin light chain cDNA ORF Clone, Human, N-GFPSpark® tag HG16460-ANG
    Ferritin light chain cDNA ORF Clone, Human, N-OFPSpark® tag HG16460-ANR
    Ferritin light chain cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16460-CF
    Ferritin light chain cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16460-NF
    Ferritin light chain cDNA ORF Clone, Human, C-His tag HG16460-CH
    Ferritin light chain cDNA ORF Clone, Human, N-His tag HG16460-NH
    Ferritin light chain cDNA ORF Clone, Human, C-HA tag HG16460-CY
    Ferritin light chain cDNA ORF Clone, Human, N-HA tag HG16460-NY
    Ferritin light chain cDNA ORF Clone, Human, C-Myc tag HG16460-CM
    Ferritin light chain cDNA ORF Clone, Human, N-Myc tag HG16460-NM
    Ferritin light chain qPCR Primer Pairs, Human HP104808
    info info
    添加购物车成功! 添加购物车失败!