Ferritin heavy chain 1 cDNA ORF Clone, Human, untagged

Cat: HG13217-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Ferritin heavy chain 1 Reagents
CRO Services
Product recommended

All Ferritin heavy chain 1 Reagents
Ferritin heavy chain 1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
552 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ferritin, heavy polypeptide 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.55kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Ferritin heavy chain 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ferritin heavy chain 1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Ferritin heavy chain 1 cDNA ORF Clone, Human, untagged Alternative Names
FHC cDNA ORF Clone, Human;FTH cDNA ORF Clone, Human;FTHL6 cDNA ORF Clone, Human;HFE5 cDNA ORF Clone, Human;PIG15 cDNA ORF Clone, Human;PLIF cDNA ORF Clone, Human
Ferritin heavy chain 1 Background Information

FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. FTH1 gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 stores iron in a soluble, non-toxic, readily available form. It is important for iron homeostasis. It has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. It also plays a role in delivery of iron to cells. FTH1 mediates iron uptake in capsule cells of the developing kidney.

Full Name
ferritin, heavy polypeptide 1
References
  • Hentze MW, et al. (1986) Cloning, characterization, expression, and chromosomal localization of a human ferritin heavy-chain gene. Proc Natl Acad Sci. 83(19):7226-30.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Stelzl, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-968.
  • Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Ferritin heavy chain 1 cDNA ORF Clone in Cloning Vector, Rhesus CG90381-G
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, untagged CG90381-UT
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90381-ACG
    Ferritin heavy chain 1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90381-ACGLN
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90381-ANG
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90381-ACR
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90381-ANR
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90381-CF
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90381-NF
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, C-His tag CG90381-CH
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, N-His tag CG90381-NH
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, C-HA tag CG90381-CY
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, N-HA tag CG90381-NY
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, C-Myc tag CG90381-CM
    Ferritin heavy chain 1 cDNA ORF Clone, Rhesus, N-Myc tag CG90381-NM

    Ferritin heavy chain 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ferritin heavy chain 1 cDNA ORF Clone in Cloning Vector, Rat RG81341-G
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, untagged RG81341-UT
    Ferritin heavy chain 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81341-ACGLN
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81341-ACG
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81341-ANG
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81341-ACR
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81341-ANR
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81341-CF
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81341-NF
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, C-His tag RG81341-CH
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, N-His tag RG81341-NH
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, C-HA tag RG81341-CY
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, N-HA tag RG81341-NY
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, C-Myc tag RG81341-CM
    Ferritin heavy chain 1 cDNA ORF Clone, Rat, N-Myc tag RG81341-NM
    Ferritin heavy chain 1 qPCR Primer Pairs, Rat RP301287

    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ferritin heavy chain 1 cDNA ORF Clone in Cloning Vector, Mouse MG51244-U
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, untagged MG51244-UT
    Ferritin heavy chain 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51244-ACGLN
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51244-ACG
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51244-ANG
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51244-ACR
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51244-ANR
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51244-CF
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51244-NF
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, C-His tag MG51244-CH
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, N-His tag MG51244-NH
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, C-HA tag MG51244-CY
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, N-HA tag MG51244-NY
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, C-Myc tag MG51244-CM
    Ferritin heavy chain 1 cDNA ORF Clone, Mouse, N-Myc tag MG51244-NM
    Ferritin heavy chain 1 qPCR Primer Pairs, Mouse MP201127

    Ferritin heavy chain 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ferritin heavy chain 1 cDNA ORF Clone in Cloning Vector, Human HG13217-G
    Ferritin heavy chain 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13217-ACGLN
    Ferritin heavy chain 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13217-ACG
    Ferritin heavy chain 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13217-ANG
    Ferritin heavy chain 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13217-ACR
    Ferritin heavy chain 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13217-ANR
    Ferritin heavy chain 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13217-CF
    Ferritin heavy chain 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13217-NF
    Ferritin heavy chain 1 cDNA ORF Clone, Human, C-His tag HG13217-CH
    Ferritin heavy chain 1 cDNA ORF Clone, Human, N-His tag HG13217-NH
    Ferritin heavy chain 1 cDNA ORF Clone, Human, C-HA tag HG13217-CY
    Ferritin heavy chain 1 cDNA ORF Clone, Human, N-HA tag HG13217-NY
    Ferritin heavy chain 1 cDNA ORF Clone, Human, C-Myc tag HG13217-CM
    Ferritin heavy chain 1 cDNA ORF Clone, Human, N-Myc tag HG13217-NM
    Ferritin heavy chain 1 qPCR Primer Pairs, Human HP101787
    info info
    添加购物车成功! 添加购物车失败!