FSTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10924-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FSTL1 Reagents
CRO Services
Product recommended

All FSTL1 Reagents
FSTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Human follistatin-like 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FSTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human FSTL1 Gene Expression validated Image 16530
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FSTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
FRP cDNA ORF Clone, Human;FSL1 cDNA ORF Clone, Human;MIR198 cDNA ORF Clone, Human
FSTL1 Background Information

Follistatin-related protein 1 (FSTL1)  is an extracellular glycoprotein whose functional significance in physiological and pathological processes is incompletely understood. Recently, we have shown that FSTL1 acts as a muscle-derived secreted factor that is up-regulated by Akt activation and ischemic stress and that FSTL1 exerts favorable actions on the heart and vasculature. Here, we sought to identify the receptor that mediates the cellular actions of FSTL1. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. FSTL1 is thought to be an autoantigen associated with rheumatoid arthritis. DIP2A functions as a novel receptor that mediates the cardiovascular protective effects of FSTL1. Experiment results have provided in vivo and in vitro evidence to demonstrate that Fstl1 modulates lung development and alveolar maturation, in part, through BMP4 signaling.

Full Name
follistatin-like 1
References
  • Rosenberg MI, et al. (2006) MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 175(1): 77-85.
  • Ouchi N, et al. (2010) DIP2A functions as a FSTL1 receptor. J Biol Chem. 285(10): 7127-34.
  • Geng Y, et al. (2011) Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 108(17): 7058-63.
  • FSTL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FSTL1 cDNA ORF Clone in Cloning Vector, Rat RG80885-U
    FSTL1 cDNA ORF Clone, Rat, untagged RG80885-UT
    FSTL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80885-ACG
    FSTL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80885-ACGLN
    FSTL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80885-ACR
    FSTL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80885-CF
    FSTL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80885-NF
    FSTL1 cDNA ORF Clone, Rat, C-His tag RG80885-CH
    FSTL1 cDNA ORF Clone, Rat, N-His tag RG80885-NH
    FSTL1 cDNA ORF Clone, Rat, C-HA tag RG80885-CY
    FSTL1 cDNA ORF Clone, Rat, N-HA tag RG80885-NY
    FSTL1 cDNA ORF Clone, Rat, C-Myc tag RG80885-CM
    FSTL1 cDNA ORF Clone, Rat, N-Myc tag RG80885-NM
    FSTL1 qPCR Primer Pairs, Rat RP300849

    FSTL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FSTL1 cDNA ORF Clone in Cloning Vector, Mouse MG51127-G
    FSTL1 cDNA ORF Clone, Mouse, untagged MG51127-UT
    FSTL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51127-ACG
    FSTL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51127-ACGLN
    FSTL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51127-ACR
    FSTL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51127-CF
    FSTL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51127-NF
    FSTL1 cDNA ORF Clone, Mouse, C-His tag MG51127-CH
    FSTL1 cDNA ORF Clone, Mouse, N-His tag MG51127-NH
    FSTL1 cDNA ORF Clone, Mouse, C-HA tag MG51127-CY
    FSTL1 cDNA ORF Clone, Mouse, N-HA tag MG51127-NY
    FSTL1 cDNA ORF Clone, Mouse, C-Myc tag MG51127-CM
    FSTL1 cDNA ORF Clone, Mouse, N-Myc tag MG51127-NM

    FSTL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FSTL1 cDNA ORF Clone in Cloning Vector, Human HG10924-U
    FSTL1 cDNA ORF Clone, Human, untagged HG10924-UT
    FSTL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10924-ACG
    FSTL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10924-ACGLN
    FSTL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10924-ACR
    FSTL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10924-CF
    FSTL1 cDNA ORF Clone, Human, C-His tag HG10924-CH
    FSTL1 cDNA ORF Clone, Human, N-His tag HG10924-NH
    FSTL1 cDNA ORF Clone, Human, C-HA tag HG10924-CY
    FSTL1 cDNA ORF Clone, Human, N-HA tag HG10924-NY
    FSTL1 cDNA ORF Clone, Human, C-Myc tag HG10924-CM
    FSTL1 cDNA ORF Clone, Human, N-Myc tag HG10924-NM
    FSTL1 qPCR Primer Pairs, Human HP100806
    info info
    添加购物车成功! 添加购物车失败!