FOLR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11219-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FOLR2 Reagents

CRO Services

Product recommended


All FOLR2 Reagents

FOLR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
807 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human folate receptor 2 (fetal) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+0.81kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FOLR2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FOLR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614

FOLR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

BETA-HFR cDNA ORF Clone, Human;FBP cDNA ORF Clone, Human;FBP/PL-1 cDNA ORF Clone, Human;FR-BETA cDNA ORF Clone, Human;FR-P3 cDNA ORF Clone, Human

FOLR2 Background Information

Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the folate receptor family. FOLR2 is expressed in placenta and hematopoietic cells. The expression of FOLR2 is increased in malignant tissues. Members of the Folate receptor family members (FOLRs) have a high affinity for folic acid and for several reduced folic acid derivatives. They mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. FOLR2 has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. The FOLR2 protein was originally thought to exist only in placenta, but is also detected in spleen, bone marrow, and thymus. FOLR2 is a marker for macrophages generated in the presence of M-CSF, but not GM-CSF. Its expression correlates with increased folate uptake ability. Folate conjugates of therapeutic drugs are a potential immunotherapy tool to target tumor-associated macrophages.

Full Name
folate receptor 2 (fetal)
References
  • van Heyningen V, et al., 1995, Cytogenet Cell Genet. 69 (3-4): 127-58.
  • Sabharanjak, S. et al., 2004, Adv Drug Deliv Rev. 56 (8): 1099-109. 
  • Scapoli, L. et al., 2005, Am J Med Genet A. 132A (3): 302-4.
  • Puig-Kröger, A. et al., 2009, Cancer Res  69 (24): 9395-403.
  • FOLR2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FOLR2 cDNA ORF Clone in Cloning Vector, Mouse MG50927-G
    FOLR2 cDNA ORF Clone, Mouse, untagged MG50927-UT
    FOLR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50927-ACGLN
    FOLR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50927-ACG
    FOLR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50927-ACR
    FOLR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50927-CF
    FOLR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50927-NF
    FOLR2 cDNA ORF Clone, Mouse, C-His tag MG50927-CH
    FOLR2 cDNA ORF Clone, Mouse, N-His tag MG50927-NH
    FOLR2 cDNA ORF Clone, Mouse, C-HA tag MG50927-CY
    FOLR2 cDNA ORF Clone, Mouse, N-HA tag MG50927-NY
    FOLR2 cDNA ORF Clone, Mouse, C-Myc tag MG50927-CM
    FOLR2 cDNA ORF Clone, Mouse, N-Myc tag MG50927-NM
    FOLR2 qPCR Primer Pairs, Mouse MP200896

    FOLR2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FOLR2 cDNA ORF Clone in Cloning Vector, Human HG11219-M
    FOLR2 cDNA ORF Clone, Human, untagged HG11219-UT
    FOLR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11219-ACG
    FOLR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11219-ACGLN
    FOLR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11219-ACR
    FOLR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11219-CF
    FOLR2 cDNA ORF Clone, Human, C-His tag HG11219-CH
    FOLR2 cDNA ORF Clone, Human, N-His tag HG11219-NH
    FOLR2 cDNA ORF Clone, Human, C-HA tag HG11219-CY
    FOLR2 cDNA ORF Clone, Human, N-HA tag HG11219-NY
    FOLR2 cDNA ORF Clone, Human, C-Myc tag HG11219-CM
    FOLR2 cDNA ORF Clone, Human, N-Myc tag HG11219-NM
    FOLR2 qPCR Primer Pairs, Human HP101120
    info info
    添加购物车成功! 添加购物车失败!