After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FOLR2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human FOLR2 cDNA Clone Product Information
NCBI RefSeq:NM_000803.4
RefSeq ORF Size:768bp
cDNA Description:Full length Clone DNA of Homo sapiens folate receptor 2 (fetal) with C terminal HA tag.
Gene Synonym:FR-P3, FR-BETA, BETA-HFR, FBP/PL-1, FOLR2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the folate receptor family. FOLR2 is expressed in placenta and hematopoietic cells. The expression of FOLR2 is increased in malignant tissues. Members of the Folate receptor family members (FOLRs) have a high affinity for folic acid and for several reduced folic acid derivatives. They mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. FOLR2 has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. The FOLR2 protein was originally thought to exist only in placenta, but is also detected in spleen, bone marrow, and thymus. FOLR2 is a marker for macrophages generated in the presence of M-CSF, but not GM-CSF. Its expression correlates with increased folate uptake ability. Folate conjugates of therapeutic drugs are a potential immunotherapy tool to target tumor-associated macrophages.

References
  • van Heyningen V, et al., 1995, Cytogenet Cell Genet. 69 (3-4): 127-58.
  • Sabharanjak, S. et al., 2004, Adv Drug Deliv Rev. 56 (8): 1099-109. 
  • Scapoli, L. et al., 2005, Am J Med Genet A. 132A (3): 302-4.
  • Puig-Kröger, A. et al., 2009, Cancer Res  69 (24): 9395-403.
  • Size / Price
    Catalog: HG11219-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"