Quick Order

Human PSMA/FOLH1/GCPII Gene ORF cDNA clone expression plasmid, C-His tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5610
DatasheetReviewsRelated ProductsProtocols
Human FOLH1 cDNA Clone Product Information
NCBI RefSeq:NM_004476.1
RefSeq ORF Size:2298 bp
cDNA Description:Full length Clone DNA of Homo sapiens folate hydrolase (prostate-specific membrane antigen) 1 with C terminal His tag.
Gene Synonym:FGCP,FOLH,GCP2,GCPII,mGCP,NAALAD1,NAALAdase,PSM,PSMA
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-FOLH1-His
Restriction Site:KpnI + XbaI(6kb+2.30kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 333A/T,732T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FOLH1 qPCR primers for gene expression analysis, HP104466 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type I I membrane protein which belongs to the peptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Size / Price
Catalog: HG15877-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"