Quick Order

Human FLT4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
DatasheetReviewsRelated ProductsProtocols
 FLT4 cDNA Clone Product Information
NCBI RefSeq:NM_182925.4
RefSeq ORF Size:4131 bp
cDNA Description:Full length Clone DNA of Homo sapiens fms related tyrosine kinase 4.
Gene Synonym:FLT-4,FLT-41,FLT41,LMPH1A,PCL,VEGFR-3,VEGFR3
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-FLT4-t1-Flag
Restriction Site:HindIII + XbaI(6kb+4.13kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3198C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FLT4 qPCR primers for gene expression analysis, HP100911 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.
  • Size / Price
    Catalog: HG29697-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"