Quick Order

DatasheetReviewsRelated ProductsProtocols
Human VEGFR1/Flt1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human VEGFR1/Flt1 Gene Plasmid Map
Human FLT1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein kinase receptor FLT, Vascular permeability factor receptor and FLT1, is a single-pass type I membrane protein and secreted protein which belongs to the protein kinase superfamily, Tyr protein kinase family and CSF-1/PDGF receptor subfamily. VEGFR-1 / FLT1 contains seven Ig-like C2-type (immunoglobulin-like) domains and one protein kinase domain. VEGFR-1 / FLT1 is expressed mostly in normal lung, but also in placenta, liver, kidney, heart and brain tissues. It is specifically expressed in most of the vascular endothelial cells, and also expressed in peripheral blood monocytes. VEGFR-1 / FLT1 is not expressed in tumor cell lines. VEGFR-1 / FLT1 is an essential receptor tyrosine kinase that regulates mammalian vascular development and embryogenesis. EGF-induced angiogenesis requires inverse regulation of VEGFR-1 and VEGFR-2 in tumor-associated endothelial cells. VEGFR-1 / FLT1 is a receptor for VEGF, VEGFB and PGF. It has a tyrosine-protein kinase activity. The VEGF-kinase ligand/receptor signaling system plays a key role in vascular development and regulation of vascular permeability.

Images
  • Human FLT1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"