FLRT1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11389-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FLRT1 Reagents
CRO Services
Product recommended

All FLRT1 Reagents
FLRT1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2025 bp
Description
Full length Clone DNA of Human fibronectin leucine rich transmembrane protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLRT1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
SPG68 cDNA ORF Clone, Human
FLRT1 Background Information

The three fibronectin leucine-rich repeat transmembrane (FLRT) proteins contain 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT1 is expressed in kidney and brain, which is a target for tyrosine phosphorylation mediated by FGFR1 and implicate a non-receptor Src family kinase (SFK). All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. The phosphorylation state of FLRT1, which is itself FGFR1 dependent, may play a critical role in the potentiation of FGFR1 signalling and may also depend on a SFK-dependent phosphorylation mechanism acting via the FGFR. This is consistent with an 'in vivo' role for FLRT1 regulation of FGF signalling via SFKs. Furthermore, the phosphorylation-dependent futile cycle mechanism controlling FGFR1 signalling is concurrently crucial for regulation of FLRT1-mediated neurite outgrowth. FLRT1, FLRT2 and FLRT3 are members of the fibronectin leucine rich transmembrane protein (FLRT) family. They may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. FLRT3 shares 55% amino acid sequence identity with FLRT1.

Full Name
fibronectin leucine rich transmembrane protein 1
References
  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Wheldon LM, et al. (2010) Critical role of FLRT1 phosphorylation in the interdependent regulation of FLRT1 function and FGF receptor signalling. PLoS One. 5(4): e10264.
  • info info
    添加购物车成功! 添加购物车失败!