Quick Order

Human FLRT1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human FLRT1 cDNA Clone Product Information
NCBI RefSeq:NM_000689.3
RefSeq ORF Size:2025bp
cDNA Description:Full length Clone DNA of Homo sapiens fibronectin leucine rich transmembrane protein 1 with C terminal Myc tag.
Gene Synonym:MGC21624, FLRT1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The three fibronectin leucine-rich repeat transmembrane (FLRT) proteins contain 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT1 is expressed in kidney and brain, which is a target for tyrosine phosphorylation mediated by FGFR1 and implicate a non-receptor Src family kinase (SFK). All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. The phosphorylation state of FLRT1, which is itself FGFR1 dependent, may play a critical role in the potentiation of FGFR1 signalling and may also depend on a SFK-dependent phosphorylation mechanism acting via the FGFR. This is consistent with an 'in vivo' role for FLRT1 regulation of FGF signalling via SFKs. Furthermore, the phosphorylation-dependent futile cycle mechanism controlling FGFR1 signalling is concurrently crucial for regulation of FLRT1-mediated neurite outgrowth. FLRT1, FLRT2 and FLRT3 are members of the fibronectin leucine rich transmembrane protein (FLRT) family. They may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. FLRT3 shares 55% amino acid sequence identity with FLRT1.

References
  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Wheldon LM, et al. (2010) Critical role of FLRT1 phosphorylation in the interdependent regulation of FLRT1 function and FGF receptor signalling. PLoS One. 5(4): e10264.
  • Size / Price
    Catalog: HG11389-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"