Quick Order

Human FKBP7 / Rotamase Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human FKBP7 cDNA Clone Product Information
NCBI RefSeq:BC009711
RefSeq ORF Size:669bp
cDNA Description:Full length Clone DNA of Homo sapiens FK506 binding protein 7 with N terminal Myc tag.
Gene Synonym:FKBP23, PPIase, FKBP7
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PPIase is a member of the immunophilin protein family. It also belongs to the cyclophilin-type PPIase family, PPIL3 subfamily. PPIase contains 1 PPIase cyclophilin-type domain. Members of the immunophilin protein family play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. It has a very high substrate specificity for the four-residue peptide Ala-Ala-Pro-Phe only when the proline peptide bond is in the trans state. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium.

References
  • 1. Shor B, et al. (2008) A new pharmacologic action of CCI-779 involves FKBP12-independent inhibition of mTOR kinase activity and profound repression of global protein synthesis. Cancer Res. 68(8):2934-43.
  • 2. Talmud PJ, et al. (2009) Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip. Am J Hum Genet. 85(5):628-42.
  • 3. Deleersnijder A, et al. (2011) Comparative analysis of different peptidyl-prolyl isomerases reveals FK506-binding protein 12 as the most potent enhancer of alpha-synuclein aggregation. J Biol Chem. 286(30):26687-701.
  • Size / Price
    Catalog: HG13250-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"