Quick Order

Text Size:AAA

Human FKBP14 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human FKBP14 cDNA Clone Product Information
NCBI RefSeq:NM_017946.2
RefSeq ORF Size:636bp
cDNA Description:Full length Clone DNA of Homo sapiens FK506 binding protein 14, 22 kDa with C terminal His tag.
Gene Synonym:FKBP22, FLJ20731, FKBP14
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FKBP14 qPCR primers for gene expression analysis, HP102209 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

FKBP14 belongs to the FK506-binding protein family. It contains 2 EF-hand domains and one PPIase FKBP-type domain. FKBP14 can be detected in the lumen of the endoplasmic reticulum where it is thought to accelerate the folding of proteins during protein synthesis. Truncation of the amino-terminus of FKBP14 significantly decreases peptidyl prolyl cis-trans isomerase activity, therefore implicating that the PPIase FKBP-type domain must be located at the N-terminus. Defects in FKBP14 can cause Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss. A syndrome with features of Ehlers-Danlos syndrome types VIA and VIB on the one hand, and the collagen VI-related congenital myopathies Ullrich congenital muscular dystrophy and Bethlem myopathy on the other hand.

References
  • Baker K, et al. (2003) The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res. 13:2265-70.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • The MGC Project Team. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14:2121-7.
  • Size / Price
    Catalog: HG13522-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"