FIS1/TTC11 cDNA ORF Clone, Human, N-His tag

Cat: HG14981-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FIS1/TTC11 Reagents
CRO Services
Product recommended

All FIS1/TTC11 Reagents
FIS1/TTC11 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Human fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FIS1/TTC11 cDNA ORF Clone, Human, N-His tag Alternative Names
CGI-135 cDNA ORF Clone, Human;TTC11 cDNA ORF Clone, Human
FIS1/TTC11 Background Information
Full Name
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)

FIS1/TTC11 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
FIS1/TTC11 cDNA ORF Clone in Cloning Vector, Canine DG70145-U

FIS1/TTC11 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
FIS1/TTC11 cDNA ORF Clone in Cloning Vector, Rhesus CG90361-G
FIS1/TTC11 cDNA ORF Clone, Rhesus, untagged CG90361-UT
FIS1/TTC11 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90361-ACGLN
FIS1/TTC11 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90361-ACG
FIS1/TTC11 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90361-ANG
FIS1/TTC11 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90361-ACR
FIS1/TTC11 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90361-ANR
FIS1/TTC11 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90361-CF
FIS1/TTC11 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90361-NF
FIS1/TTC11 cDNA ORF Clone, Rhesus, C-His tag CG90361-CH
FIS1/TTC11 cDNA ORF Clone, Rhesus, N-His tag CG90361-NH
FIS1/TTC11 cDNA ORF Clone, Rhesus, C-HA tag CG90361-CY
FIS1/TTC11 cDNA ORF Clone, Rhesus, N-HA tag CG90361-NY
FIS1/TTC11 cDNA ORF Clone, Rhesus, C-Myc tag CG90361-CM
FIS1/TTC11 cDNA ORF Clone, Rhesus, N-Myc tag CG90361-NM

FIS1/TTC11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FIS1/TTC11 cDNA ORF Clone in Cloning Vector, Mouse MG52366-G
FIS1/TTC11 cDNA ORF Clone, Mouse, untagged MG52366-UT
FIS1/TTC11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52366-ACGLN
FIS1/TTC11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52366-ACG
FIS1/TTC11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52366-ANG
FIS1/TTC11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52366-ACR
FIS1/TTC11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52366-ANR
FIS1/TTC11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52366-CF
FIS1/TTC11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52366-NF
FIS1/TTC11 cDNA ORF Clone, Mouse, C-His tag MG52366-CH
FIS1/TTC11 cDNA ORF Clone, Mouse, N-His tag MG52366-NH
FIS1/TTC11 cDNA ORF Clone, Mouse, C-HA tag MG52366-CY
FIS1/TTC11 cDNA ORF Clone, Mouse, N-HA tag MG52366-NY
FIS1/TTC11 cDNA ORF Clone, Mouse, C-Myc tag MG52366-CM
FIS1/TTC11 cDNA ORF Clone, Mouse, N-Myc tag MG52366-NM
FIS1/TTC11 qPCR Primer Pairs, Mouse MP202239

FIS1/TTC11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FIS1/TTC11 cDNA ORF Clone in Cloning Vector, Human HG14981-G
FIS1/TTC11 cDNA ORF Clone, Human, untagged HG14981-UT
FIS1/TTC11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14981-ACGLN
FIS1/TTC11 cDNA ORF Clone, Human, C-GFPSpark® tag HG14981-ACG
FIS1/TTC11 cDNA ORF Clone, Human, N-GFPSpark® tag HG14981-ANG
FIS1/TTC11 cDNA ORF Clone, Human, C-OFPSpark® tag HG14981-ACR
FIS1/TTC11 cDNA ORF Clone, Human, N-OFPSpark® tag HG14981-ANR
FIS1/TTC11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14981-CF
FIS1/TTC11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14981-NF
FIS1/TTC11 cDNA ORF Clone, Human, C-His tag HG14981-CH
FIS1/TTC11 cDNA ORF Clone, Human, C-HA tag HG14981-CY
FIS1/TTC11 cDNA ORF Clone, Human, N-HA tag HG14981-NY
FIS1/TTC11 cDNA ORF Clone, Human, C-Myc tag HG14981-CM
FIS1/TTC11 cDNA ORF Clone, Human, N-Myc tag HG14981-NM
FIS1/TTC11 qPCR Primer Pairs, Human HP103609
info info
添加购物车成功! 添加购物车失败!