FIBP cDNA ORF Clone, Human, N-Myc tag

Cat: HG15492-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FIBP Reagents
CRO Services
Product recommended

All FIBP Reagents
FIBP cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Human fibroblast growth factor (acidic) intracellular binding protein with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FIBP cDNA ORF Clone, Human, N-Myc tag Alternative Names
FGFIBP cDNA ORF Clone, Human;FIBP-1 cDNA ORF Clone, Human
FIBP Background Information
Full Name
fibroblast growth factor (acidic) intracellular binding protein
Research Areas

FIBP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FIBP cDNA ORF Clone in Cloning Vector, Mouse MG53548-G
FIBP cDNA ORF Clone, Mouse, untagged MG53548-UT
FIBP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53548-ACGLN
FIBP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53548-ACG
FIBP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53548-ANG
FIBP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53548-ACR
FIBP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53548-ANR
FIBP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53548-CF
FIBP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53548-NF
FIBP cDNA ORF Clone, Mouse, C-His tag MG53548-CH
FIBP cDNA ORF Clone, Mouse, N-His tag MG53548-NH
FIBP cDNA ORF Clone, Mouse, C-HA tag MG53548-CY
FIBP cDNA ORF Clone, Mouse, N-HA tag MG53548-NY
FIBP cDNA ORF Clone, Mouse, C-Myc tag MG53548-CM
FIBP cDNA ORF Clone, Mouse, N-Myc tag MG53548-NM

FIBP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FIBP cDNA ORF Clone in Cloning Vector, Human HG15492-G
FIBP cDNA ORF Clone, Human, untagged HG15492-UT
FIBP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15492-ACGLN
FIBP cDNA ORF Clone, Human, C-GFPSpark® tag HG15492-ACG
FIBP cDNA ORF Clone, Human, N-GFPSpark® tag HG15492-ANG
FIBP cDNA ORF Clone, Human, C-OFPSpark® tag HG15492-ACR
FIBP cDNA ORF Clone, Human, N-OFPSpark® tag HG15492-ANR
FIBP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15492-CF
FIBP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15492-NF
FIBP cDNA ORF Clone, Human, C-His tag HG15492-CH
FIBP cDNA ORF Clone, Human, N-His tag HG15492-NH
FIBP cDNA ORF Clone, Human, C-HA tag HG15492-CY
FIBP cDNA ORF Clone, Human, N-HA tag HG15492-NY
FIBP cDNA ORF Clone, Human, C-Myc tag HG15492-CM
FIBP qPCR Primer Pairs, Human HP104114
info info
添加购物车成功! 添加购物车失败!