Quick Order

Text Size:AAA

Human Fumarate Hydratase Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human FH cDNA Clone Product Information
NCBI RefSeq:NM_000143.3
RefSeq ORF Size:1533bp
cDNA Description:Full length Clone DNA of Homo sapiens fumarate hydratase with N terminal HA tag.
Gene Synonym:MCL, LRCC, HLRCC, MCUL1, FH
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Fumarate Hydratase (FH) is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. Fumarate Hydratase is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. Individuals with hemizygous germline fumarate hydratase (FH) mutations are predisposed to renal cancer. These tumors predominantly exhibit functional inactivation of the remaining wild-type allele, implicating FH inactivation as a tumor-promoting event.

References
  • King A, et al. (2005) Succinate dehydrogenase and fumarate hydratase: linking mitochondrial dysfunction and cancer. Oncogene. 25(34): 4675-82.
  • Alam NA, et al. (2003) Genetic and functional analyses of FH mutations in multiple cutaneous and uterine leiomyomatosis, hereditary leiomyomatosis and renal cancer, and fumarate hydratase deficiency. Hum Mol Genet.12(11): 1241-52.
  • Pollard PJ, et al. (2003) The TCA cycle and tumorigenesis: the examples of fumarate hydratase and succinate dehydrogenase. Ann Med. 35(8): 632-9.
  • Size / Price
    Catalog: HG12115-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"