FGFRL1 cDNA ORF Clone, Human, C-HA tag

Cat: HG13589-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGFRL1 Reagents
CRO Services
Product recommended

All FGFRL1 Reagents
FGFRL1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Description
Full length Clone DNA of Human fibroblast growth factor receptor-like 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGFRL1 cDNA ORF Clone, Human, C-HA tag Alternative Names
FGFR5 cDNA ORF Clone, Human;FHFR cDNA ORF Clone, Human
FGFRL1 Background Information

Fibroblast growth factor receptor-like 1 (FGFRL1) also known as Fibroblast growth factor receptor 5 (FGFR5), is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A unique feature of FGFRL1/FGFR5 is that it does not contain an intracellular tyrosine kinase domain. Some muscle types, including the muscles of the tongue and the diaphragm, express FGFRL1/FGFR5 at relatively high level. In contrast, the heart and the skeletal muscles of the limbs, as well as many other organs (brain, lung, liver, kidney, gut) express Fgfrl1 only at basal level. It is conceivable that FGFRL1/FGFR5 interacts with other Fgfrs, which are expressed in cartilage and muscle, to modulate FGF signaling.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
fibroblast growth factor receptor-like 1
References
  • Wiedemann M, et al. (2000) Characterization of a novel protein (FGFRL1) from human cartilage related to FGF receptors. Genomics. 69(2): 275-9.
  • Trueb B, et al. (2006) Expression of FGFRL1, a novel fibroblast growth factor receptor, during embryonic development. Int J Mol Med. 17(4): 617-20.
  • Wiedemann M, et al. (2001) The mouse Fgfrl1 gene coding for a novel FGF receptor-like protein. Biochim Biophys Acta. 1520(3): 247-50.
  • Trueb B, et al. (2003) Characterization of FGFRL1, a novel fibroblast growth factor (FGF) receptor preferentially expressed in skeletal tissues. J Biol Chem. 278(36): 33857-65.
  • FGFRL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGFRL1 cDNA ORF Clone in Cloning Vector, Mouse MG50182-M
    FGFRL1 cDNA ORF Clone, Mouse, untagged MG50182-UT
    FGFRL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50182-ACGLN
    FGFRL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50182-ACG
    FGFRL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50182-ACR
    FGFRL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50182-CF
    FGFRL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50182-NF
    FGFRL1 cDNA ORF Clone, Mouse, C-His tag MG50182-CH
    FGFRL1 cDNA ORF Clone, Mouse, N-His tag MG50182-NH
    FGFRL1 cDNA ORF Clone, Mouse, C-HA tag MG50182-CY
    FGFRL1 cDNA ORF Clone, Mouse, N-HA tag MG50182-NY
    FGFRL1 cDNA ORF Clone, Mouse, C-Myc tag MG50182-CM
    FGFRL1 cDNA ORF Clone, Mouse, N-Myc tag MG50182-NM
    FGFRL1 qPCR Primer Pairs, Mouse MP200212

    FGFRL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGFRL1 cDNA ORF Clone in Cloning Vector, Human HG13589-G
    FGFRL1 cDNA ORF Clone, Human, untagged HG13589-UT
    FGFRL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13589-ACG
    FGFRL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13589-ACGLN
    FGFRL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13589-ACR
    FGFRL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13589-CF
    FGFRL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13589-NF
    FGFRL1 cDNA ORF Clone, Human, C-His tag HG13589-CH
    FGFRL1 cDNA ORF Clone, Human, N-His tag HG13589-NH
    FGFRL1 cDNA ORF Clone, Human, N-HA tag HG13589-NY
    FGFRL1 cDNA ORF Clone, Human, C-Myc tag HG13589-CM
    FGFRL1 cDNA ORF Clone, Human, N-Myc tag HG13589-NM
    FGFRL1 qPCR Primer Pairs, Human HP102275
    info info
    添加购物车成功! 添加购物车失败!