FGFR4 cDNA ORF Clone, Human, N-HA tag

Cat: HG10538-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGFR4 Reagents
CRO Services
Product recommended

All FGFR4 Reagents
FGFR4 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2409 bp
Description
Full length Clone DNA of Human fibroblast growth factor receptor 4 , transcript variant 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGFR4 cDNA ORF Clone, Human, N-HA tag Alternative Names
CD334 cDNA ORF Clone, Human;JTK2 cDNA ORF Clone, Human;TKF cDNA ORF Clone, Human
FGFR4 Background Information

Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast growth factor receptor, is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR4/CD334 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR4/CD334 preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. FGFR4/CD334 signaling is down-regulated by receptor internalization and degradation; MMP14 promotes internalization and degradation of FGFR4/CD334. Mutations in FGFR4/CD334 lead to constitutive kinase activation or impair normal FGFR4 inactivation lead to aberrant signaling.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
fibroblast growth factor receptor 4
References
  • Hart KC, et al. (2000) Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene. 19(29): 3309-20.
  • Xie MH, et al. (1999) FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine. 11(10): 729-35.
  • Yu C, et al. (2000) Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem. 275(20): 15482-9.
  • FGFR4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGFR4 cDNA ORF Clone in Cloning Vector, Mouse MG50194-M
    FGFR4 cDNA ORF Clone, Mouse, untagged MG50194-UT
    FGFR4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50194-ACG
    FGFR4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50194-ACGLN
    FGFR4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50194-ACR
    FGFR4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50194-CF
    FGFR4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50194-NF
    FGFR4 cDNA ORF Clone, Mouse, C-His tag MG50194-CH
    FGFR4 cDNA ORF Clone, Mouse, N-His tag MG50194-NH
    FGFR4 cDNA ORF Clone, Mouse, C-HA tag MG50194-CY
    FGFR4 cDNA ORF Clone, Mouse, N-HA tag MG50194-NY
    FGFR4 cDNA ORF Clone, Mouse, C-Myc tag MG50194-CM
    FGFR4 cDNA ORF Clone, Mouse, N-Myc tag MG50194-NM
    FGFR4 qPCR Primer Pairs, Mouse MP200224

    FGFR4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGFR4 cDNA ORF Clone in Cloning Vector, Human HG10538-M
    FGFR4 cDNA ORF Clone, Human, untagged HG10538-UT
    FGFR4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10538-ACG
    FGFR4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10538-ACGLN
    FGFR4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10538-ACR
    FGFR4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10538-CF
    FGFR4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10538-NF
    FGFR4 cDNA ORF Clone, Human, C-His tag HG10538-CH
    FGFR4 cDNA ORF Clone, Human, N-His tag HG10538-NH
    FGFR4 cDNA ORF Clone, Human, C-HA tag HG10538-CY
    FGFR4 cDNA ORF Clone, Human, C-Myc tag HG10538-CM
    FGFR4 cDNA ORF Clone, Human, N-Myc tag HG10538-NM
    FGFR4 qPCR Primer Pairs, Human HP100554

    FGFR4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FGFR4 qPCR Primer Pairs, Rat RP300089
    info info
    添加购物车成功! 添加购物车失败!