Quick Order

Human FGFR3/CD333 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human FGFR3 cDNA Clone Product Information
    NCBI RefSeq:NM_000142.4
    RefSeq ORF Size:2421bp
    cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 3 with N terminal His tag.
    Gene Synonym:ACH, CEK2, JTK4, CD333, HSFGFR3EX
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. FGFRs are transmembrane catalytic receptors that have intracellular tyrosine kinase activity. Mutations in FGFR genes are the cause of several human developmental disorders characterized by skeletal abnormalities such as achondroplasia, and upregulation of FGFR expression may lead to cell transformation and cancer. FGFR3, a full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR3 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR3 binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in FGFR3 gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. CD333 is the receptor for acidic and basic fibroblast growth factors.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Keegan K, et al. (1991) Isolation of an additional member of the fibroblast growth factor receptor family, FGFR-3. Proc Natl Acad Sci. 88(4):1095-9.
  • Hafner C, et al. (2007) FGFR3 mutations in epidermal nevi and seborrheic keratoses: lessons from urothelium and skin. J Invest Dermatol. 127(7):1572-3.
  • Lamy A, et al. (2006) Molecular profiling of bladder tumors based on the detection of FGFR3 and TP53 mutations. J Urol. 176(6 Pt 1):2686-9.
  • Schweitzer DN, et al. (2001) Subtle radiographic findings of achondroplasia in patients with Crouzon syndrome with acanthosis nigricans due to an Ala391Glu substitution in FGFR3. Am J Med Genet. 98 (1):75-91.
  • Size / Price
    Catalog: HG16044-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"