FGFR2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10824-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGFR2 Reagents
CRO Services
Product recommended

All FGFR2 Reagents
FGFR2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2466 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 189 G/A, 726 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human fibroblast growth factor receptor 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
KpnI + XbaI (6kb + 2.5kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FGFR2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGFR2 cDNA ORF Clone, Human, N-Myc tag Validated Images
Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630
FGFR2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
BBDS cDNA ORF Clone, Human;BEK cDNA ORF Clone, Human;BFR-1 cDNA ORF Clone, Human;CD332 cDNA ORF Clone, Human;CEK3 cDNA ORF Clone, Human;CFD1 cDNA ORF Clone, Human;ECT1 cDNA ORF Clone, Human;JWS cDNA ORF Clone, Human;K-SAM cDNA ORF Clone, Human;KGFR cDNA ORF Clone, Human;TK14 cDNA ORF Clone, Human;TK25 cDNA ORF Clone, Human
FGFR2 Background Information

FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR2 acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. It is required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. FGFR2 plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. It also promotes cell proliferation in keratinocytes and imature osteoblasts, but promotes apoptosis in differentiated osteoblasts. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal CD332 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. Defects in CD3322 are the cause of Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, Beare-Stevenson cutis gyrata syndrome, familial scaphocephaly syndrome, lacrimo-auriculo-dento-digital syndrome and Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
fibroblast growth factor receptor 2
References
  • Marie PJ, et al. (2003) Regulation of human cranial osteoblast phenotype by FGF-2, FGFR-2 and BMP-2 signaling. Histol. 17(3):877-85.
  • Park WJ, et al. (1996) Novel FGFR2 mutations in Crouzon and Jackson-Weiss syndromes show allelic heterogeneity and phenotypic variability. Hum Mol Genet. 4(7):1229-33.
  • Orr-Urtreger A, et al. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol. 158(2):475-86.
  • FGFR2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FGFR2 cDNA ORF Clone in Cloning Vector, Rat RG82013-U
    FGFR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82013-ACGLN

    FGFR2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGFR2 cDNA ORF Clone in Cloning Vector, Mouse MG51128-G
    FGFR2 cDNA ORF Clone, Mouse, untagged MG51128-UT
    FGFR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51128-ACG
    FGFR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51128-ACGLN
    FGFR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51128-ACR
    FGFR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51128-CF
    FGFR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51128-NF
    FGFR2 cDNA ORF Clone, Mouse, C-His tag MG51128-CH
    FGFR2 cDNA ORF Clone, Mouse, N-His tag MG51128-NH
    FGFR2 cDNA ORF Clone, Mouse, C-HA tag MG51128-CY
    FGFR2 cDNA ORF Clone, Mouse, N-HA tag MG51128-NY
    FGFR2 cDNA ORF Clone, Mouse, C-Myc tag MG51128-CM
    FGFR2 cDNA ORF Clone, Mouse, N-Myc tag MG51128-NM

    FGFR2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGFR2 cDNA ORF Clone in Cloning Vector, Human HG10824-M
    FGFR2 cDNA ORF Clone, Human, untagged HG10824-UT
    FGFR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10824-ACG
    FGFR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10824-ACGLN
    FGFR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10824-ACR
    FGFR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10824-CF
    FGFR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10824-NF
    FGFR2 cDNA ORF Clone, Human, C-His tag HG10824-CH
    FGFR2 cDNA ORF Clone, Human, N-His tag HG10824-NH
    FGFR2 cDNA ORF Clone, Human, C-HA tag HG10824-CY
    FGFR2 cDNA ORF Clone, Human, N-HA tag HG10824-NY
    FGFR2 cDNA ORF Clone, Human, C-Myc tag HG10824-CM
    FGFR2 qPCR Primer Pairs, Human HP100917
    info info
    添加购物车成功! 添加购物车失败!