Quick Order

Human FGFR2/CD332 Gene ORF cDNA clone expression plasmid, N-His tag

  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
DatasheetReviewsRelated ProductsProtocols
Human FGFR2 cDNA Clone Product Information
NCBI RefSeq:NM_000141.4
RefSeq ORF Size:2496 bp
cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 2 with N terminal His tag.
Gene Synonym:BEK, JWS, CEK3, CFD1, ECT1, KGFR, TK14, TK25, BFR-1, CD332, K-SAM, FLJ98662, FGFR2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-SP-His-FGFR2
Restriction Site:KpnI + XbaI(6kb+2.5kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 189g/a,726a/g not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FGFR2 qPCR primers for gene expression analysis, HP100917 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR2 acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. It is required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. FGFR2 plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. It also promotes cell proliferation in keratinocytes and imature osteoblasts, but promotes apoptosis in differentiated osteoblasts. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal CD332 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. Defects in CD3322 are the cause of Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, Beare-Stevenson cutis gyrata syndrome, familial scaphocephaly syndrome, lacrimo-auriculo-dento-digital syndrome and Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Marie PJ, et al. (2003) Regulation of human cranial osteoblast phenotype by FGF-2, FGFR-2 and BMP-2 signaling. Histol. 17(3):877-85.
  • Park WJ, et al. (1996) Novel FGFR2 mutations in Crouzon and Jackson-Weiss syndromes show allelic heterogeneity and phenotypic variability. Hum Mol Genet. 4(7):1229-33.
  • Orr-Urtreger A, et al. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol. 158(2):475-86.
  • Size / Price
    Catalog: HG10824-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"