Quick Order

Text Size:AAA

Human FOP / FGFR1OP Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FGFR1OP cDNA Clone Product Information
NCBI RefSeq:BC011902
RefSeq ORF Size:1140bp
cDNA Description:Full length Clone DNA of Homo sapiens FGFR1 oncogene partner.
Gene Synonym:FOP, FGFR1OP
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

FOP( fibroblast growth factor receptor 1 oncogene partner) is a largely hydrophilic protein postulated to be a leucine-rich protein family member. FOP contains 1 LisH domain. A t(6;8)(q27;p11) chromosomal translocation, fusing FOP gene and the fibroblast growth factor receptor 1 (FGFR1) gene, has been found in cases of myeloproliferative disorder. The resulting chimeric protein contains the N-terminal leucine-rich region of this encoded protein fused to the catalytic domain of FGFR1. FOP gene is thought to play an important role in normal proliferation and differentiation of the erythroid lineage. Alternatively spliced transcript variants that encode different proteins have been identified.

References
  • Reither A. et al., 1999, Med Klin (Munich). 94 (4): 207-10.
  • Guasch G. et al., 2004, Blood. 103 (1): 309-12.
  • Popovici C. et al., 1999, Blood. 93 (4): 1381-9.
  • Size / Price
    Catalog: HG14414-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"