Quick Order

Text Size:AAA

Human KSP37/FGFBP2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FGFBP2 cDNA Clone Product Information
NCBI RefSeq:BC025720
RefSeq ORF Size:672bp
cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor binding protein 2.
Gene Synonym:KSP37, HBP17RP, FGFBP2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FGFBP2
Restriction Site:KpnI + XbaI (6.1kb + 0.67kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 180T>C and 252C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FGFBP2 Gene Plasmid Map
Human FGFBP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG12139-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human FGFBP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"