Quick Order

Human FGF6 / FGF-6 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human FGF6 cDNA Clone Product Information
NCBI RefSeq:NM_020996.1
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor 6 with N terminal His tag.
Gene Synonym:HST2, HBGF-6, FGF6
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

FGF6, also known as FGF-6, belongs to the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF6 plays an important role in the regulation of cell proliferation, cell differentiation, angiogenesis and myogenesis. It is also required for normal muscle regeneration. FGF6 gene displayed oncogenic transforming activity when transfected into mammalian cells.

References
  • Marics I, et al. (1989) Characterization of the HST-related FGF.6 gene, a new member of the fibroblast growth factor gene family. Oncogene. 4(3):335-40.
  • Coulier F, et al. (1991) Putative structure of the FGF6 gene product and role of the signal peptide. Oncogene. 6(8):1437-44.
  • Iida S, et al. (1992) Human hst-2 (FGF-6) oncogene: cDNA cloning and characterization. Oncogene. 7(2):303-9.
  • Size / Price
    Catalog: HG11528-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"